Home > 分離済み変異体 > tm420

分離済み変異体

Allele Name		tm420
Allele Type		通常株
Sequence Name		W06D12.3
Gene Name		fat-5
Worm Base	Allele Name	tm420
	Gene Name	fat-5
	Sequence	W06D12.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. H. Arai: WT (Brood size, embryonic lethality, larval lehtality, growth rate), Dr. M. Han: slow growth, dumpish, mono-unsaturated fatty acids N17 are decreased. Dr. K. Sakamoto: J. Biochem 144, 149 (2008). Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006), Genetics 176, 865 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		19998/19999-20777/20778 (779 bp deletion)
Chromosome		V
Putative gene structure		join(19946..20159, 20215..20551, 21208..21658)
Map position		13.08
Balancer
Map position of balancer
Sequence of primers		ExtFwd:TCACACAACTTGTTTGCCTC,IntFwd:ACAGACTCCGCCCCTTCTTT,IntRev:CGACCGAATTTTGGGCAAAA,ExtRev:GGATTGGCCTAGCCCAAACT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Zhou H, Yang Y, Kang Y, Guo T, Zhou Y, Zhang Y, Ma L. Synergistic toxicity induced by the co-exposure of tenuazonic acid and patulin in Caenorhabditis elegans: Daf-16 plays an important regulatory role. Ecotoxicol Environ Saf 2024 270 115871  [ PubMed ID = 38141335 ] [ RRC reference ] Shi H, Zhao J, Li Y, Li J, Li Y, Zhang J, Qiu Z, Wu C, Qin M, Liu C, Zeng Z, Zhang C, Gao L. Ginsenosides Rg1 regulate lipid metabolism and temperature adaptation in Caenorhabditis elegans. J Ginseng Res 2023 47(4) 524-533  [ PubMed ID = 37397410 ] [ RRC reference ] Weng JW, Park H, Valotteau C, Chen RT, Essmann CL, Pujol N, Sternberg PW, Chen CH. Body stiffness is a mechanical property that facilitates contact-mediated mate recognition in Caenorhabditis elegans. Curr Biol 2023 33(17) 3585-3596.e5  [ PubMed ID = 37541249 ] [ RRC reference ] Zhao L, Wu B, Liang S, Min D, Jiang H. Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans. Foods 2022 11(24)   [ PubMed ID = 36553826 ] [ RRC reference ] Qu Z, Zhang L, Huang W, Zheng S. Vitamin K2 Enhances Fat Degradation to Improve the Survival of C. elegans. Front Nutr 2022 9 858481  [ PubMed ID = 35495953 ] [ RRC reference ] Mudd N, Liceaga AM. Caenorhabditis elegans as an in vivo model for food bioactives: A review. Curr Res Food Sci 2022 5 845-856  [ PubMed ID = 35619588 ] [ RRC reference ] Goncalves J, Wan Y, Garcia LR. Stearoyl-CoA desaturases sustain cholinergic excitation and copulatory robustness in metabolically aging C. elegansmales. iScience 2022 25(4) 104082  [ PubMed ID = 35372802 ] [ RRC reference ] Casorla-Perez LA, Guennoun R, Cubillas C, Peng B, Kornfeld K, Wang D. Orsay Virus Infection of Caenorhabditis elegans Is Modulated by Zinc and Dependent on Lipids. J Virol 2022 96(22) e0121122  [ PubMed ID = 36342299 ] [ RRC reference ] Yue Y, Hao G, Cho J, Park Y. Curcumin reduced fat accumulation in Caenorhabditis elegans. Curr Res Food Sci 2021 4 551-556  [ PubMed ID = 34458861 ] [ RRC reference ] Wan QL, Meng X, Wang C, Dai W, Luo Z, Yin Z, Ju Z, Fu X, Yang J, Ye Q, Zhang ZH, Zhou Q. Histone H3K4me3 modification is a transgenerational epigenetic signal for lipid metabolism in Caenorhabditis elegans. Nat Commun 2022 13(1) 768  [ PubMed ID = 35140229 ] [ RRC reference ] Ow MC, Nichitean AM, Hall SE. Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans. Elife 2021 10   [ PubMed ID = 34236316 ] [ RRC reference ] Liu J, Peng Y, Yue Y, Shen P, Park Y. Epigallocatechin-3-Gallate Reduces Fat Accumulation in Caenorhabditis elegans. Prev Nutr Food Sci 2018 23(3) 214-219  [ PubMed ID = 30386749 ] [ RRC reference ] Nakamura S, Karalay Ö, Jäger PS, Horikawa M, Klein C, Nakamura K, Latza C, Templer SE, Dieterich C, Antebi A. Mondo complexes regulate TFEB via TOR inhibition to promote longevity in response to gonadal signals. Nat Commun 2016 7 10944  [ PubMed ID = 27001890 ] [ RRC reference ] Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ. SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat. Genes Dev 2015 29(23) 2490-503  [ PubMed ID = 26637528 ] [ RRC reference ] He B, Zhang J, Wang Y, Li Y, Zou X, Liang B. Identification of cytochrome b5 CYTB-5.1 and CYTB-5.2 in C. elegans; evidence for differential regulation of SCD. Biochim Biophys Acta Mol Cell Biol Lipids 2018 1863(3) 235-246  [ PubMed ID = 29237573 ] [ RRC reference ] Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A. Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan. Nature 2017 544(7649) 185-190  [ PubMed ID = 28379943 ] [ RRC reference ] Le TT, Duren HM, Slipchenko MN, Hu CD, Cheng JX. Label-free quantitative analysis of lipid metabolism in living Caenorhabditis elegans. J Lipid Res 2010 51(3) 672-7  [ PubMed ID = 19776402 ] [ RRC reference ] Marsh EK, van den Berg MC, May RC. A two-gene balance regulates Salmonella typhimurium tolerance in the nematode Caenorhabditis elegans. PLoS One 2011 6(3) e16839  [ PubMed ID = 21399680 ] [ RRC reference ] Horikawa M, Sakamoto K. Polyunsaturated fatty acids are involved in regulatory mechanism of fatty acid homeostasis via daf-2/insulin signaling in Caenorhabditis elegans. Mol Cell Endocrinol 2010 323(2) 183-92  [ PubMed ID = 20226839 ] [ RRC reference ] Goudeau J, Bellemin S, Toselli-Mollereau E, Shamalnasab M, Chen Y, Aguilaniu H. Fatty acid desaturation links germ cell loss to longevity through NHR-80/HNF4 in C. elegans. PLoS Biol 2011 9(3) e1000599  [ PubMed ID = 21423649 ] [ RRC reference ]