Mutants (Isolated)

tm420

Allele Nametm420
Sequence NameW06D12.3
CGC Namefat-5
Worm BaseAllele Name tm420
CGC Name fat-5
Sequence W06D12.3
Phenotypehomozygous viable. Dr. H. Arai: WT (Brood size, embryonic lethality, larval lehtality, growth rate), Dr. M. Han: slow growth, dumpish, mono-unsaturated fatty acids N17 are decreased. Dr. K. Sakamoto: J. Biochem 144, 149 (2008). Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006), Genetics 176, 865 (2007).
Mutation site19998/19999-20777/20778 (779 bp deletion)
ChromosomeV
Putative gene structurejoin(19946..20159, 20215..20551, 21208..21658)
Map position13.08
Balancer
Map position of balancer
Sequence of primersExtFwd:TCACACAACTTGTTTGCCTC,IntFwd:ACAGACTCCGCCCCTTCTTT,IntRev:CGACCGAATTTTGGGCAAAA,ExtRev:GGATTGGCCTAGCCCAAACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu J, Peng Y, Yue Y, Shen P, Park Y.
Epigallocatechin-3-Gallate Reduces Fat Accumulation in Caenorhabditis elegans.
Prev Nutr Food Sci 2018 23(3) 214-219 
[ PubMed ID = 30386749 ] [ RRC reference ]

Nakamura S, Karalay Ö, Jäger PS, Horikawa M, Klein C, Nakamura K, Latza C, Templer SE, Dieterich C, Antebi A.
Mondo complexes regulate TFEB via TOR inhibition to promote longevity in response to gonadal signals.
Nat Commun 2016 7 10944 
[ PubMed ID = 27001890 ] [ RRC reference ]

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ.
SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat.
Genes Dev 2015 29(23) 2490-503 
[ PubMed ID = 26637528 ] [ RRC reference ]

He B, Zhang J, Wang Y, Li Y, Zou X, Liang B.
Identification of cytochrome b5 CYTB-5.1 and CYTB-5.2 in C. elegans; evidence for differential regulation of SCD.
Biochim Biophys Acta Mol Cell Biol Lipids 2018 1863(3) 235-246 
[ PubMed ID = 29237573 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190 
[ PubMed ID = 28379943 ] [ RRC reference ]

Le TT, Duren HM, Slipchenko MN, Hu CD, Cheng JX.
Label-free quantitative analysis of lipid metabolism in living Caenorhabditis elegans.
J Lipid Res 2010 51(3) 672-7 
[ PubMed ID = 19776402 ] [ RRC reference ]

Marsh EK, van den Berg MC, May RC.
A two-gene balance regulates Salmonella typhimurium tolerance in the nematode Caenorhabditis elegans.
PLoS One 2011 6(3) e16839 
[ PubMed ID = 21399680 ] [ RRC reference ]

Horikawa M, Sakamoto K.
Polyunsaturated fatty acids are involved in regulatory mechanism of fatty acid homeostasis via daf-2/insulin signaling in Caenorhabditis elegans.
Mol Cell Endocrinol 2010 323(2) 183-92 
[ PubMed ID = 20226839 ] [ RRC reference ]

Goudeau J, Bellemin S, Toselli-Mollereau E, Shamalnasab M, Chen Y, Aguilaniu H.
Fatty acid desaturation links germ cell loss to longevity through NHR-80/HNF4 in C. elegans.
PLoS Biol 2011 9(3) e1000599 
[ PubMed ID = 21423649 ] [ RRC reference ]

Savory FR, Sait SM, Hope IA.
DAF-16 and Δ9 desaturase genes promote cold tolerance in long-lived Caenorhabditis elegans age-1 mutants.
PLoS One 2011 6(9) e24550 
[ PubMed ID = 21931751 ] [ RRC reference ]

Bettinger JC, Leung K, Bolling MH, Goldsmith AD, Davies AG.
Lipid environment modulates the development of acute tolerance to ethanol in Caenorhabditis elegans.
PLoS One 2012 7(5) e35192 
[ PubMed ID = 22574115 ] [ RRC reference ]

Vásquez V, Krieg M, Lockhead D, Goodman MB.
Phospholipids that contain polyunsaturated fatty acids enhance neuronal cell mechanics and touch sensation.
Cell Rep 2014 6(1) 70-80 
[ PubMed ID = 24388754 ] [ RRC reference ]

Shi X, Li J, Zou X, Greggain J, Rødkær SV, Færgeman NJ, Liang B, Watts JL.
Regulation of lipid droplet size and phospholipid composition by stearoyl-CoA desaturase.
J Lipid Res 2013 54(9) 2504-14 
[ PubMed ID = 23787165 ] [ RRC reference ]

Castro C, Sar F, Shaw WR, Mishima M, Miska EA, Griffin JL.
A metabolomic strategy defines the regulation of lipid content and global metabolism by Δ9 desaturases in Caenorhabditis elegans.
BMC Genomics 2012 13 36 
[ PubMed ID = 22264337 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS One 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]

Wang P, Liu B, Zhang D, Belew MY, Tissenbaum HA, Cheng JX.
Imaging lipid metabolism in live Caenorhabditis elegans using fingerprint vibrations.
Angew Chem Int Ed Engl 2014 53(44) 11787-92 
[ PubMed ID = 25195517 ] [ RRC reference ]

Garcia AM, Ladage ML, Dumesnil DR, Zaman K, Shulaev V, Azad RK, Padilla PA.
Glucose induces sensitivity to oxygen deprivation and modulates insulin/IGF-1 signaling and lipid biosynthesis in Caenorhabditis elegans.
Genetics 2015 200(1) 167-84 
[ PubMed ID = 25762526 ] [ RRC reference ]

Murray P, Hayward SA, Govan GG, Gracey AY, Cossins AR.
An explicit test of the phospholipid saturation hypothesis of acquired cold tolerance in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2007 104(13) 5489-94 
[ PubMed ID = 17369360 ] [ RRC reference ]

Brock TJ, Browse J, Watts JL.
Genetic regulation of unsaturated fatty acid composition in C. elegans.
PLoS Genet 2006 2(7) e108 
[ PubMed ID = 16839188 ] [ RRC reference ]

Brock TJ, Browse J, Watts JL.
Fatty acid desaturation and the regulation of adiposity in Caenorhabditis elegans.
Genetics 2007 176(2) 865-75 
[ PubMed ID = 17435249 ] [ RRC reference ]