Home > Mutants (Isolated) > tm4085

Mutants (Isolated)

Allele Name		tm4085
Allele Type		Normal
Sequence Name		Y74C9A.2
Gene Name		nlp-40
Worm Base	Allele Name	tm4085
	Gene Name	nlp-40
	Sequence	Y74C9A.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		Let or Ste. Dr. M. Nonet: Gro
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		14698/14699-14944/14945 (246 bp deletion)
Chromosome		I
Putative gene structure		join(11581..11629, 14891..15100, 16413..16525)
Map position		-21.66
Balancer
Map position of balancer
Sequence of primers		IntFwd:AGTCGCCACATATCCCGAGA,ExtFwd:ATCTAGATTGAATCGGCCGA,IntRev:GTACCTATTCCGGGTTTGGA,ExtRev:ATGGGATGACGCAGGAATGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Choi U, Hu M, Zhang Q, Sieburth D. The head mesodermal cell couples FMRFamide neuropeptide signaling with rhythmic muscle contraction in C. elegans. Nat Commun 2023 14(1) 4218  [ PubMed ID = 37452027 ] [ RRC reference ] Liu J, Zhang P, Zheng Z, Afridi MI, Zhang S, Wan Z, Zhang X, Stingelin L, Wang Y, Tu H. GABAergic signaling between enteric neurons and intestinal smooth muscle promotes innate immunity and gut defense in Caenorhabditis elegans. Immunity 2023 56(7) 1515-1532.e9  [ PubMed ID = 37437538 ] [ RRC reference ] Shi Y, Qin L, Wu M, Zheng J, Xie T, Shao Z. Gut neuroendocrine signaling regulates synaptic assembly in C. elegans. EMBO Rep 2022 23(8) e53267  [ PubMed ID = 35748387 ] [ RRC reference ] Lin-Moore AT, Oyeyemi MJ, Hammarlund M. rab-27 acts in an intestinal pathway to inhibit axon regeneration in C. elegans. PLoS Genet 2021 17(11) e1009877  [ PubMed ID = 34818334 ] [ RRC reference ] Choi U, Wang H, Hu M, Kim S, Sieburth D. Presynaptic coupling by electrical synapses coordinates a rhythmic behavior by synchronizing the activities of a neuron pair. Proc Natl Acad Sci U S A 2021 118(20)   [ PubMed ID = 33972428 ] [ RRC reference ] Wang H, Sieburth D. PKA controls calcium influx into motor neurons during a rhythmic behavior. PLoS Genet 2013 9(9) e1003831  [ PubMed ID = 24086161 ] [ RRC reference ] Wang H, Girskis K, Janssen T, Chan JP, Dasgupta K, Knowles JA, Schoofs L, Sieburth D. Neuropeptide secreted from a pacemaker activates neurons to control a rhythmic behavior. Curr Biol 2013 23(9) 746-54  [ PubMed ID = 23583549 ] [ RRC reference ]