分離済み変異体

tm4067

Allele Name

tm4067

Allele Type

通常株

Sequence Name

K02F3.4

Gene Name

zip-2

Worm Base

Allele Name

tm4067

Gene Name

zip-2

Sequence

K02F3.4

Phenotype

homozygous viable. Dr. J. Kaplan: non-Egl, non-Dpy, non-Sma.

Mutation site

12094/12095-A-12405/12406 (311 bp deletion + 1 bp insertion)

Chromosome

III

Putative gene structure

join(11760..11768, 11821..12136, 12193..12513, 12628..12908)

Map position

-25.78

Balancer

Map position of balancer

Sequence of primers

IntFwd:GGTATTTTTCAGCAAGGGAC,ExtRev:TGCGCCCACGTGTTATTGTC,IntRev:ATGGGTTCAGACGATGACGT,ExtFwd:GCGTCCGCTCTAACGTGGTT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Kim E, Annibal A, Lee Y, Park HH, Ham S, Jeong DE, Kim Y, Park S, Kwon S, Jung Y, Park J, Kim SS, Antebi A, Lee SV.
Mitochondrial aconitase suppresses immunity by modulating oxaloacetate and the mitochondrial unfolded protein response.
Nat Commun 2023 14(1) 3716
[ PubMed ID = 37349299 ] [ RRC reference ]

Yoon S, Kilicarslan You D, Jeong U, Lee M, Kim E, Jeon TJ, Kim SM.
Microfluidics in High-Throughput Drug Screening: Organ-on-a-Chip and C. elegans-Based Innovations.
Biosensors (Basel) 2024 14(1)
[ PubMed ID = 38275308 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Jeong DE, Lee D, Hwang SY, Lee Y, Lee JE, Seo M, Hwang W, Seo K, Hwang AB, Artan M, Son HG, Jo JH, Baek H, Oh YM, Ryu Y, Kim HJ, Ha CM, Yoo JY, Lee SV.
Mitochondrial chaperone HSP-60 regulates anti-bacterial immunity via p38 MAP kinase signaling.
EMBO J 2017 36(8) 1046-1065
[ PubMed ID = 28283579 ] [ RRC reference ]

Estes KA, Dunbar TL, Powell JR, Ausubel FM, Troemel ER.
bZIP transcription factor zip-2 mediates an early response to Pseudomonas aeruginosa infection in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2010 107(5) 2153-8
[ PubMed ID = 20133860 ] [ RRC reference ]

Pukkila-Worley R, Feinbaum R, Kirienko NV, Larkins-Ford J, Conery AL, Ausubel FM.
Stimulation of host immune defenses by a small molecule protects C. elegans from bacterial infection.
PLoS Genet 2012 8(6) e1002733
[ PubMed ID = 22719261 ] [ RRC reference ]

McEwan DL, Kirienko NV, Ausubel FM.
Host translational inhibition by Pseudomonas aeruginosa Exotoxin A Triggers an immune response in Caenorhabditis elegans.
Cell Host Microbe 2012 11(4) 364-74
[ PubMed ID = 22520464 ] [ RRC reference ]

Dunbar TL, Yan Z, Balla KM, Smelkinson MG, Troemel ER.
C. elegans detects pathogen-induced translational inhibition to activate immune signaling.
Cell Host Microbe 2012 11(4) 375-86
[ PubMed ID = 22520465 ] [ RRC reference ]

Melo JA, Ruvkun G.
Inactivation of conserved C. elegans genes engages pathogen- and xenobiotic-associated defenses.
Cell 2012 149(2) 452-66
[ PubMed ID = 22500807 ] [ RRC reference ]