Mutants (Isolated)

tm4067

Allele Nametm4067
Sequence NameK02F3.4
CGC Namezip-2
Worm BaseAllele Name tm4067
CGC Name zip-2
Sequence K02F3.4
Phenotypehomozygous viable. Dr. J. Kaplan: non-Egl, non-Dpy, non-Sma.
Mutation site12094/12095-A-12405/12406 (311 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurejoin(11760..11768, 11821..12136, 12193..12513, 12628..12908)
Map position-25.78
Balancer
Map position of balancer
Sequence of primersIntFwd:GGTATTTTTCAGCAAGGGAC,ExtRev:TGCGCCCACGTGTTATTGTC,IntRev:ATGGGTTCAGACGATGACGT,ExtFwd:GCGTCCGCTCTAACGTGGTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Melo JA, Ruvkun G.
Inactivation of conserved C. elegans genes engages pathogen- and xenobiotic-associated defenses.
Cell 2012 149(2) 452-66 
[ PubMed ID = 22500807 ] [ RRC reference ]

Jeong DE, Lee D, Hwang SY, Lee Y, Lee JE, Seo M, Hwang W, Seo K, Hwang AB, Artan M, Son HG, Jo JH, Baek H, Oh YM, Ryu Y, Kim HJ, Ha CM, Yoo JY, Lee SV.
Mitochondrial chaperone HSP-60 regulates anti-bacterial immunity via p38 MAP kinase signaling.
EMBO J. 2017 36(8) 1046-1065 
[ PubMed ID = 28283579 ] [ RRC reference ]

Pukkila-Worley R, Feinbaum R, Kirienko NV, Larkins-Ford J, Conery AL, Ausubel FM.
Stimulation of host immune defenses by a small molecule protects C. elegans from bacterial infection.
PLoS Genet. 2012 8(6) e1002733 
[ PubMed ID = 22719261 ] [ RRC reference ]

Estes KA, Dunbar TL, Powell JR, Ausubel FM, Troemel ER.
bZIP transcription factor zip-2 mediates an early response to Pseudomonas aeruginosa infection in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(5) 2153-8 
[ PubMed ID = 20133860 ] [ RRC reference ]

Dunbar TL, Yan Z, Balla KM, Smelkinson MG, Troemel ER.
C. elegans detects pathogen-induced translational inhibition to activate immune signaling.
Cell Host Microbe 2012 11(4) 375-86 
[ PubMed ID = 22520465 ] [ RRC reference ]

McEwan DL, Kirienko NV, Ausubel FM.
Host translational inhibition by Pseudomonas aeruginosa Exotoxin A Triggers an immune response in Caenorhabditis elegans.
Cell Host Microbe 2012 11(4) 364-74 
[ PubMed ID = 22520464 ] [ RRC reference ]