Mutants (Isolated)

tm4063

Allele Nametm4063
Allele TypeBalanced
Sequence NameM142.1
Gene Nameunc-119
Worm BaseAllele Name tm4063
Gene Name unc-119
Sequence M142.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4197/4198-ATTAAC-4807/4808 (610 bp deletion + 6 bp insertion)
ChromosomeIII
Putative gene structurejoin(3511..3570, 4639..4750, 4821..5201, 5689..5795)
Map position5.57
BalancerhT2
Map position of balancer
Sequence of primersIntFwd:GGTTCAATCAGGGGTGGCAC,ExtFwd:CCTTTCGGTGGTTCAATCAG,IntRev:TCTCTTCGATGCACCATGAG,ExtRev:ATCGGAGCGGGTCTCGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wong MK, Ho VWS, Huang X, Chan LY, Xie D, Li R, Ren X, Guan G, Ma Y, Hu B, Yan H, Zhao Z.
Initial characterization of gap phase introduction in every cell cycle of C. elegans embryogenesis.
Front Cell Dev Biol 2022 10 978962 
[ PubMed ID = 36393848 ] [ RRC reference ]

Murray JI, Preston E, Crawford JP, Rumley JD, Amom P, Anderson BD, Sivaramakrishnan P, Patel SD, Bennett BA, Lavon TD, Hsiao E, Peng F, Zacharias AL.
The anterior Hox gene ceh-13 and elt-1/GATA activate the posterior Hox genes nob-1 and php-3 to specify posterior lineages in the C. elegans embryo.
PLoS Genet 2022 18(5) e1010187 
[ PubMed ID = 35500030 ] [ RRC reference ]

Mallick A, Xu L, Mehta S, Taylor SKB, Hosein H, Gupta BP.
The FGFR4 Homolog KIN-9 Regulates Lifespan and Stress Responses in Caenorhabditis elegans.
Front Aging 2022 3 866861 
[ PubMed ID = 35821842 ] [ RRC reference ]

Jofré DM, Hoffman DK, Cervino AS, Hahn GM, Grundy M, Yun S, Amrit FRG, Stolz DB, Godoy LF, Salvatore E, Rossi FA, Ghazi A, Cirio MC, Yanowitz JL, Hochbaum D.
The CHARGE syndrome ortholog CHD-7 regulates TGF-β pathways in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2022 119(15) e2109508119 
[ PubMed ID = 35394881 ] [ RRC reference ]

Vidal B, Gulez B, Cao WX, Leyva-Díaz E, Reilly MB, Tekieli T, Hobert O.
The enteric nervous system of the C. elegans pharynx is specified by the Sine oculis-like homeobox gene ceh-34.
Elife 2022 11  
[ PubMed ID = 35324425 ] [ RRC reference ]

Sallee MD, Pickett MA, Feldman JL.
Apical PAR complex proteins protect against programmed epithelial assaults to create a continuous and functional intestinal lumen.
Elife 2021 10  
[ PubMed ID = 34137371 ] [ RRC reference ]

Mony VK, Drangowska-Way A, Albert R, Harrison E, Ghaddar A, Horak MK, Ke W, O'Rourke EJ.
Context-specific regulation of lysosomal lipolysis through network-level diverting of transcription factor interactions.
Proc Natl Acad Sci U S A 2021 118(41)  
[ PubMed ID = 34607947 ] [ RRC reference ]

Jeong H, Park JY, Lee JH, Baik JH, Kim CY, Cho JY, Driscoll M, Paik YK.
Deficiency in RCAT-1 Function Causes Dopamine Metabolism Related Behavioral Disorders in Caenorhabditis elegans.
Int J Mol Sci 2022 23(4)  
[ PubMed ID = 35216508 ] [ RRC reference ]

Ding Q, Li R, Ren X, Chan LY, Ho VWS, Xie D, Ye P, Zhao Z.
Genomic architecture of 5S rDNA cluster and its variations within and between species.
BMC Genomics 2022 23(1) 238 
[ PubMed ID = 35346033 ] [ RRC reference ]

Blazie SM, Takayanagi-Kiya S, McCulloch KA, Jin Y.
Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity.
Elife 2021 10  
[ PubMed ID = 34323215 ] [ RRC reference ]

Omi S, Pujol N.
unc-119 mutants have an increased fungal spore adhesion that is not rescued by Cb-unc-119.
MicroPubl Biol 2021 2021  
[ PubMed ID = 33543000 ] [ RRC reference ]

Gabaldón C, Legüe M, Palominos MF, Verdugo L, Gutzwiller F, Calixto A.
Intergenerational Pathogen-Induced Diapause in Caenorhabditis elegans Is Modulated by mir-243.
mBio 2020 11(5)  
[ PubMed ID = 32963007 ] [ RRC reference ]

Heimbucher T, Hog J, Gupta P, Murphy CT.
PQM-1 controls hypoxic survival via regulation of lipid metabolism.
Nat Commun 2020 11(1) 4627 
[ PubMed ID = 33009389 ] [ RRC reference ]

Li Y, Ding W, Li CY, Liu Y.
HLH-11 modulates lipid metabolism in response to nutrient availability.
Nat Commun 2020 11(1) 5959 
[ PubMed ID = 33235199 ] [ RRC reference ]

Shi C, Booth LN, Murphy CT.
Insulin-like peptides and the mTOR-TFEB pathway protect Caenorhabditis elegans hermaphrodites from mating-induced death.
Elife 2019 8  
[ PubMed ID = 31282862 ] [ RRC reference ]

Lee J, Taylor CA, Barnes KM, Shen A, Stewart EV, Chen A, Xiang YK, Bao Z, Shen K.
A Myt1 family transcription factor defines neuronal fate by repressing non-neuronal genes.
Elife 2019 8  
[ PubMed ID = 31386623 ] [ RRC reference ]

Jordan JM, Hibshman JD, Webster AK, Kaplan REW, Leinroth A, Guzman R, Maxwell CS, Chitrakar R, Bowman EA, Fry AL, Hubbard EJA, Baugh LR.
Insulin/IGF Signaling and Vitellogenin Provisioning Mediate Intergenerational Adaptation to Nutrient Stress.
Curr Biol 2019 29(14) 2380-2388.e5 
[ PubMed ID = 31280992 ] [ RRC reference ]

Han M, Wei G, McManus CE, Hillier LW, Reinke V.
Isolated C. elegans germ nuclei exhibit distinct genomic profiles of histone modification and gene expression.
BMC Genomics 2019 20(1) 500 
[ PubMed ID = 31208332 ] [ RRC reference ]

Feng W, Li Y, Dao P, Aburas J, Islam P, Elbaz B, Kolarzyk A, Brown AE, Kratsios P.
A terminal selector prevents a Hox transcriptional switch to safeguard motor neuron identity throughout life.
Elife 2020 9  
[ PubMed ID = 31902393 ] [ RRC reference ]

Dowen RH.
CEH-60/PBX and UNC-62/MEIS Coordinate a Metabolic Switch that Supports Reproduction in C. elegans.
Dev Cell 2019 49(2) 235-250.e7 
[ PubMed ID = 30956009 ] [ RRC reference ]