Mutants (Isolated)

tm4063

Allele Nametm4063
Sequence NameM142.1
CGC Nameunc-119
Worm BaseAllele Name tm4063
CGC Name unc-119
Sequence M142.1
Phenotypelethal or sterile
Mutation site4197/4198-ATTAAC-4807/4808 (610 bp deletion + 6 bp insertion)
ChromosomeIII
Putative gene structurejoin(3511..3570, 4639..4750, 4821..5201, 5689..5795)
Map position5.57
BalancerhT2
Map position of balancer
Sequence of primersIntFwd:GGTTCAATCAGGGGTGGCAC,ExtFwd:CCTTTCGGTGGTTCAATCAG,IntRev:TCTCTTCGATGCACCATGAG,ExtRev:ATCGGAGCGGGTCTCGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Liu W, Yu E, Chen S, Ma X, Lu Y, Liu X.
Spatiotemporal expression profiling of long intervening noncoding RNAs in Caenorhabditis elegans.
Sci Rep 2017 7(1) 5195 
[ PubMed ID = 28701691 ] [ RRC reference ]

Kudron MM, Victorsen A, Gevirtzman L, Hillier LW, Fisher WW, Vafeados D, Kirkey M, Hammonds AS, Gersch J, Ammouri H, Wall ML, Moran J, Steffen D, Szynkarek M, Seabrook-Sturgis S, Jameel N, Kadaba M, Patton J, Terrell R, Corson M, Durham TJ, Park S, Samanta S, Han M, Xu J, Yan KK, Celniker SE, White KP, Ma L, Gerstein M, Reinke V, Waterston RH.
The ModERN Resource: Genome-Wide Binding Profiles for Hundreds of Drosophila and Caenorhabditis elegans Transcription Factors.
Genetics 2018 208(3) 937-949 
[ PubMed ID = 29284660 ] [ RRC reference ]

Cohen ML, Kim S, Morita K, Kim SH, Han M.
The GATA factor elt-1 regulates C. elegans developmental timing by promoting expression of the let-7 family microRNAs.
PLoS Genet. 2015 11(3) e1005099 
[ PubMed ID = 25816370 ] [ RRC reference ]

Walton T, Preston E, Nair G, Zacharias AL, Raj A, Murray JI.
The Bicoid class homeodomain factors ceh-36/OTX and unc-30/PITX cooperate in C. elegans embryonic progenitor cells to regulate robust development.
PLoS Genet. 2015 11(3) e1005003 
[ PubMed ID = 25738873 ] [ RRC reference ]

Wernike D, van Oostende C, Piekny A.
Visualizing neuroblast cytokinesis during C. elegans embryogenesis.
J Vis Exp 2014 (85)  
[ PubMed ID = 24686748 ] [ RRC reference ]

Tang H, Han M.
Fatty Acids Regulate Germline Sex Determination through ACS-4-Dependent Myristoylation.
Cell 2017 169(3) 457-469.e13 
[ PubMed ID = 28431246 ] [ RRC reference ]

Heestand BN, Shen Y, Liu W, Magner DB, Storm N, Meharg C, Habermann B, Antebi A.
Dietary restriction induced longevity is mediated by nuclear receptor NHR-62 in Caenorhabditis elegans.
PLoS Genet. 2013 9(7) e1003651 
[ PubMed ID = 23935515 ] [ RRC reference ]

Takayanagi-Kiya S, Jin Y.
Altered Function of the DnaJ Family Cochaperone DNJ-17 Modulates Locomotor Circuit Activity in a Caenorhabditis elegans Seizure Model.
G3 (Bethesda). 2016 6(7) 2165-71. 
[ PubMed ID = -1 ] [ RRC reference ]

McManus CE, Reinke V.
The Germline-Specific Factor OEF-1 Facilitates Coordinated Progression Through Germ Cell Development in Caenorhabditis elegans.
Genetics 2018 208(2) 549-563 
[ PubMed ID = 29167199 ] [ RRC reference ]

Botts MR, Cohen LB, Probert CS, Wu F, Troemel ER.
Microsporidia Intracellular Development Relies on Myc Interaction Network Transcription Factors in the Host.
G3 (Bethesda) 2016 6(9) 2707-16 
[ PubMed ID = 27402359 ] [ RRC reference ]

Chen HD, Kao CY, Liu BY, Huang SW, Kuo CJ, Ruan JW, Lin YH, Huang CR, Chen YH, Wang HD, Aroian RV, Chen CS.
HLH-30/TFEB-mediated autophagy functions in a cell-autonomous manner for epithelium intrinsic cellular defense against bacterial pore-forming toxin in C. elegans.
Autophagy 2017 13(2) 371-385 
[ PubMed ID = 27875098 ] [ RRC reference ]