Mutants (Isolated)

tm4033

Allele Nametm4033
Sequence NameF58F9.7
CGC NameF58F9.7
Worm BaseAllele Name tm4033
CGC Name F58F9.7
Sequence F58F9.7
Phenotypehomozygous viable.
Mutation site18985/18986-19399/19400 (414 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(16214..16325, 16377..16918, 16969..17083, 17186..17359, 17408..17504, 17552..17652, 18130..18451, 18504..18645, 18806..18973, 19020..19151, 19196..19294))
Map position3.09
Balancer
Map position of balancer
Sequence of primersExtFwd:TCTATACGGCCGGCGTCGTA,ExtRev:GACTACACTCTTCCTACCCA,IntRev:CCTACCCAGTACATATGCAA,IntFwd:GGCCGGCGTCGTAAAGTATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang X, Wang Y, Perez DH, Jones Lipinski RA, Butcher RA.
Acyl-CoA Oxidases Fine-Tune the Production of Ascaroside Pheromones with Specific Side Chain Lengths.
ACS Chem. Biol. 2018 13(4) 1048-1056 
[ PubMed ID = 29537254 ] [ RRC reference ]

Zhou Y, Wang Y, Zhang X, Bhar S, Jones Lipinski RA, Han J, Feng L, Butcher RA.
Biosynthetic tailoring of existing ascaroside pheromones alters their biological function in C. elegans.
Elife 2018 7  
[ PubMed ID = 29863473 ] [ RRC reference ]