Mutants (Isolated)

tm4022

Allele Nametm4022
Allele TypeNormal
Sequence NameY22D7AL.8
Gene Namesms-3
Worm BaseAllele Name tm4022
Gene Name sms-3
Sequence Y22D7AL.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9642/9643-10242/10243 (600 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(7355..7387, 8513..8774, 9733..9956, 11695..11948, 13039..13288))
Map position-20.11
Balancer
Map position of balancer
Sequence of primersExtRev:GGCCCCATAGCTCAAATTTA,IntFwd:CGCAGGGTACTGTACCTCGA,IntRev:CCGTGGTGTTTGCGTACCTA,ExtFwd:GCCGGGTAATTTTAGGACGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]

Cui M, Wang Y, Cavaleri J, Kelson T, Teng Y, Han M.
Starvation-Induced Stress Response Is Critically Impacted by Ceramide Levels in Caenorhabditis elegans.
Genetics 2017 205(2) 775-785 
[ PubMed ID = 27974500 ] [ RRC reference ]