Mutants (Isolated)

tm402

Allele Nametm402
Sequence NameC35B8.2
CGC Namevav-1
Worm BaseAllele Name tm402
CGC Name vav-1
Sequence C35B8.2
Phenotypelethal or sterile. Er. V. Maricq: L1 lethal that has a severe pharyngeal pumping defects.
Mutation site21310/21311-22783/22784 (1473 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(17370..17471, 17567..17657, 17701..17949, 18248..18357, 19218..19405, 20149..20297, 20344..20921, 21020..21224, 21534..21844, 22331..22412, 22480..22620, 22752..22927, 22981..23071, 23321..23430))
Map position1.05
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntFwd:CCGGAAAGAATGAAATGCCA,ExtRev:GCATTTTCAGGTGCCCATGA,ExtFwd:GTTGCTGGATTCTTAACGTC,IntRev:ATTGGGTGCGCCCGATGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Norman KR, Fazzio RT, Mellem JE, Espelt MV, Strange K, Beckerle MC, Maricq AV.
The Rho/Rac-family guanine nucleotide exchange factor VAV-1 regulates rhythmic behaviors in C. elegans.
Cell 2005 123(1) 119-32 
[ PubMed ID = 16213217 ] [ RRC reference ]