Mutants (Isolated)

tm399

Allele Nametm399
Sequence NameC12D8.10
CGC Nameakt-1
Worm BaseAllele Name tm399
CGC Name akt-1
Sequence C12D8.10
Phenotypehomozygous viable. Dr. K. Ashrafi: substantially increased fat (nile red staining) and slight developmental delay. Dr. T. Schedl: fertile, normal locomotion.
Mutation site30815/30816-31165/31166(350 bp deletion)
ChromosomeV
Putative gene structurejoin(30791..30894, 31690..31798, 31873..32061, 32107..32268, 32314..32511, 32676..32867, 33512..33640, 33688..34050, 34107..34286)
Map position2.42
Balancer
Map position of balancer
Sequence of primersIntRev:CCAGCCATGATAAGTTCGAA,ExtRev:CTTGCTTGGGAACCTTAGAT,IntFwd:CGGTGAAAGAATGTCGATGA,ExtFwd:TTTACGACGGCGCCGGTGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Christensen R, de la Torre-Ubieta L, Bonni A, Colón-Ramos DA.
A conserved PTEN/FOXO pathway regulates neuronal morphology during C. elegans development.
Development 2011 138(23) 5257-67 
[ PubMed ID = 22069193 ] [ RRC reference ]

Nakagawa A, Sullivan KD, Xue D.
Caspase-activated phosphoinositide binding by CNT-1 promotes apoptosis by inhibiting the AKT pathway.
Nat. Struct. Mol. Biol. 2014 21(12) 1082-90 
[ PubMed ID = 25383666 ] [ RRC reference ]

Nawa M, Kage-Nakadai E, Aiso S, Okamoto K, Mitani S, Matsuoka M.
Reduced expression of BTBD10, an Akt activator, leads to motor neuron death.
Cell Death Differ. 2012 19(8) 1398-407 
[ PubMed ID = 22388351 ] [ RRC reference ]