Mutants (Isolated)

tm3945

Allele Nametm3945
BalanceNot Required
OutCrossNot Accepted
Sequence NameC49F5.1
Gene Namesams-1
Worm BaseAllele Name tm3945
Gene Name sams-1
Sequence C49F5.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7540/7541-TT-8011/8012 (471 bp deletion + 2 bp insertion)
ChromosomeX
Putative gene structurejoin(7332..7400, 7454..7637, 7692..8484, 8532..8697)
Map position6.8
Balancer
Map position of balancer
Sequence of primersExtRev:GGCGAGGTGTTGGTCATCTA,IntRev:CTATTGGTGCCTAGCATACA,ExtFwd:CTGGGTTGTCTGTGTGACTC,IntFwd:AAGGGCAGTGTCCGACTGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yang Y, Kong Q, Liu C, Wang F, Li M, Li S, Shi Y, Krall L, Wang X, He S, Jiang K, Wu X, Yang M, Yang C.
Homocysteine disrupts lysosomal function by V-ATPase inhibition.
J Cell Biol 2026 225(1)  
[ PubMed ID = 41288572 ] [ RRC reference ]