Mutants (Isolated)

tm3898

Allele Nametm3898
Sequence NameY53F4B.4
CGC NameY53F4B.4
Worm BaseAllele Name tm3898
CGC Name Y53F4B.4
Sequence Y53F4B.4
Phenotypehomozygous viable.
Mutation site22761/22762-23689/23690 (928 bp deletion)
ChromosomeII
Putative gene structurejoin(18500..18601, 21001..21303, 22248..22505, 23337..23452, 23638..23776, 24554..24670, 25466..25750)
Map position23.85
Balancer
Map position of balancer
Sequence of primersIntRev:CAATCGCGAATTTGACCTGA,ExtRev:AGCACGGAGGGTCTACAATC,IntFwd:CGGGACACTGAAACCCGAGA,ExtFwd:TGGACTGCAGATGAAGCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Navarro IC, Tuorto F, Jordan D, Legrand C, Price J, Braukmann F, Hendrick AG, Akay A, Kotter A, Helm M, Lyko F, Miska EA.
Translational adaptation to heat stress is mediated by RNA 5-methylcytosine in Caenorhabditis elegans.
EMBO J 2021 40(6) e105496 
[ PubMed ID = 33283887 ] [ RRC reference ]

Heissenberger C, Rollins JA, Krammer TL, Nagelreiter F, Stocker I, Wacheul L, Shpylovyi A, Tav K, Snow S, Grillari J, Rogers AN, Lafontaine DLJ, Schosserer M.
The ribosomal RNA m5C methyltransferase NSUN-1 modulates healthspan and oogenesis in Caenorhabditis elegans.
Elife 2020 9  
[ PubMed ID = 33289480 ] [ RRC reference ]

Schosserer M, Minois N, Angerer TB, Amring M, Dellago H, Harreither E, Calle-Perez A, Pircher A, Gerstl MP, Pfeifenberger S, Brandl C, Sonntagbauer M, Kriegner A, Linder A, Weinhäusel A, Mohr T, Steiger M, Mattanovich D, Rinnerthaler M, Karl T, Sharma S, Entian KD, Kos M, Breitenbach M, Wilson IB, Polacek N, Grillari-Voglauer R, Breitenbach-Koller L, Grillari J.
Methylation of ribosomal RNA by NSUN5 is a conserved mechanism modulating organismal lifespan.
Nat Commun 2015 6 6158 
[ PubMed ID = 25635753 ] [ RRC reference ]