Mutants (Isolated)

tm3862

Allele Nametm3862
BalanceCompleted
OutCrossNot Accepted
Sequence NameB0035.5
Gene Namegspd-1
Worm BaseAllele Name tm3862 (x1)
Gene Name gspd-1
Sequence B0035.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24113/24114-24524/24525 (411 bp deletion)
ChromosomeIV
Putative gene structurejoin(23132..23257, 23311..23517, 23934..24009, 24054..24306, 24365..24666, 24728..24865, 24918..25119, 25171..25347, 25401..25488)
Map position4.95
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:TGTGGTGGTTGTTCCGTGAC,IntRev:GGATCGCTTTAATTCACCAG,ExtRev:CCAGGTTTCTTGGTCATCAG,IntFwd:TGCCCGTTCCGATCTGACAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yanagi KS, Jochim B, Kunjo SO, Breen P, Ruvkun G, Lehrbach N.
Mutations in nucleotide metabolism genes bypass proteasome defects in png-1/NGLY1-deficient Caenorhabditis elegans.
PLoS Biol 2024 22(7) e3002720 
[ PubMed ID = 38991033 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]