Mutants (Isolated)

tm3859

Allele Nametm3859
Sequence NameC04G6.1a
CGC Namempk-2
Worm BaseAllele Name tm3859
CGC Name mpk-2
Sequence C04G6.1a
Phenotypehomozygous viable.
Mutation site23040/23041-GCACGCTAACCCGGAGCAGGT-23563/23564 (523 bp deletion + 21 bp insertion)
ChromosomeII
Putative gene structurejoin(22762..22860, 22938..23069, 23126..23407, 23709..23867, 23915..23982, 24393..24645, 24695..24801, 25110..25223, 25914..26038, 26087..26330, 26825..26954, 27003..27107)
Map position-2.17
Balancer
Map position of balancer
Sequence of primersExtRev:CCTCTATTACGGGAACAAGT,IntRev:CGATACCAACGTGTTGATAC,ExtFwd:GAGAGAGGAGCCGAAAGGGA,IntFwd:TGTGCGAATTAGCACGAAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li G, Gong J, Lei H, Liu J, Xu XZ.
Promotion of behavior and neuronal function by reactive oxygen species in C. elegans.
Nat Commun 2016 7 13234 
[ PubMed ID = 27824033 ] [ RRC reference ]