Mutants (Isolated)

tm3859

Allele Nametm3859
BalanceNot Required
OutCrossNot Accepted
Sequence NameC04G6.1a
Gene Namempk-2
Worm BaseAllele Name tm3859
Gene Name mpk-2
Sequence C04G6.1a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 23040/23041-GCACGCTAACCCGGAGCAGGT-23563/23564 (523 bp deletion + 21 bp insertion)
ChromosomeII
Putative gene structurejoin(22762..22860, 22938..23069, 23126..23407, 23709..23867, 23915..23982, 24393..24645, 24695..24801, 25110..25223, 25914..26038, 26087..26330, 26825..26954, 27003..27107)
Map position-2.17
Balancer
Map position of balancer
Sequence of primersExtRev:CCTCTATTACGGGAACAAGT,IntRev:CGATACCAACGTGTTGATAC,ExtFwd:GAGAGAGGAGCCGAAAGGGA,IntFwd:TGTGCGAATTAGCACGAAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li G, Gong J, Lei H, Liu J, Xu XZ.
Promotion of behavior and neuronal function by reactive oxygen species in C. elegans.
Nat Commun 2016 7 13234 
[ PubMed ID = 27824033 ] [ RRC reference ]