分離済み変異体

tm3858

Allele Nametm3858
BalanceCompleted
OutCrossNot Accepted
Sequence NameC01H6.9
Gene Namehasp-1
Worm BaseAllele Name tm3858 (x1)
Gene Name hasp-1
Sequence C01H6.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 38758/38759-39223/39224 (465 bp deletion)
ChromosomeI
Putative gene structurejoin(complement(Z71266.1:588..775), complement(Z71266.1:395..539), complement(Z71266.1:169..295), complement(Z98261.1:204..368), complement(Z98261.1:105..155), complement(40294..40359), complement(40101..40244), complement(39857..39994), complement(39258..39701), complement(38262..39212), complement(38105..38207), complement(37940..38057), complement(37773..37895))
Map position1.85
BalancerhT2
Map position of balancer
Sequence of primersIntRev:CACGATCGGAAGCATTGTCT,ExtRev:CGGCGAAGCAACTAGACGAC,IntFwd:ATAACTTCAGGCAGAACGAC,ExtFwd:CCTTTAGGATACTTCCCCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Macaraeg J, Reinhard I, Ward M, Carmeci D, Stanaway M, Moore A, Hagmann E, Brown K, Wynne DJ.
Genetic analysis of Caenorhabditis elegans Haspin-like genes shows that hasp-1 plays multiple roles in the germline.
Biol Open 2022 11(7)  
[ PubMed ID = 35678140 ] [ RRC reference ]