Mutants (Isolated)

tm385

Allele Nametm385
Sequence NameC42D8.8
CGC Nameapl-1
Worm BaseAllele Name tm385
CGC Name apl-1
Sequence C42D8.8
Phenotypeembryonic or larval lethal. Dr. H. Suzuki: mild decrease of chemotaxis to NaCl.
Mutation site36526/36527-37172/37173 (646 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(34150..34470, 34519..34647, 34700..34898, 34948..35130, 35174..35370, 35424..35633, 35773..35906, 35960..36052, 36189..36422, 36606..36732, 37221..37388, 37849..37914))
Map position-5.9
Balancerlon-2 (e678) X
Map position of balancer-6.32
Sequence of primersExtFwd:GCGGTGGTTGTTGGAGCCTT,ExtRev:TAATTGCAAAGGGGTTTGCG,IntRev:TCGATTCCCACTGACTCGTA,IntFwd:TTCACGTCAAGTTTGGCGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wiese M, Antebi A, Zheng H.
Intracellular trafficking and synaptic function of APL-1 in Caenorhabditis elegans.
PLoS ONE 2010 5(9)  
[ PubMed ID = 20862215 ] [ RRC reference ]

Wiese M, Antebi A, Zheng H.
Regulation of neuronal APL-1 expression by cholesterol starvation.
PLoS ONE 2012 7(2) e32038 
[ PubMed ID = 22363792 ] [ RRC reference ]