分離済み変異体

tm385

Allele Nametm385
BalanceCompleted
OutCrossNot Accepted
Sequence NameC42D8.8
Gene Nameapl-1
Worm BaseAllele Name tm385 (x1)
Gene Name apl-1
Sequence C42D8.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" embryonic or larval lethal. Dr. H. Suzuki: mild decrease of chemotaxis to NaCl.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36526/36527-37172/37173 (646 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(34150..34470, 34519..34647, 34700..34898, 34948..35130, 35174..35370, 35424..35633, 35773..35906, 35960..36052, 36189..36422, 36606..36732, 37221..37388, 37849..37914))
Map position-5.9
Balancerlon-2 (e678) X
Map position of balancer
Sequence of primersExtFwd:GCGGTGGTTGTTGGAGCCTT,ExtRev:TAATTGCAAAGGGGTTTGCG,IntRev:TCGATTCCCACTGACTCGTA,IntFwd:TTCACGTCAAGTTTGGCGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Teuscher AC, Statzer C, Goyala A, Domenig SA, Schoen I, Hess M, Hofer AM, Fossati A, Vogel V, Goksel O, Aebersold R, Ewald CY.
Longevity interventions modulate mechanotransduction and extracellular matrix homeostasis in C. elegans.
Nat Commun 2024 15(1) 276 
[ PubMed ID = 38177158 ] [ RRC reference ]

Wiese M, Antebi A, Zheng H.
Regulation of neuronal APL-1 expression by cholesterol starvation.
PLoS One 2012 7(2) e32038 
[ PubMed ID = 22363792 ] [ RRC reference ]

Wiese M, Antebi A, Zheng H.
Intracellular trafficking and synaptic function of APL-1 in Caenorhabditis elegans.
PLoS One 2010 5(9)  
[ PubMed ID = 20862215 ] [ RRC reference ]