Home > Mutants (Isolated) > tm385

Mutants (Isolated)

Allele Name		tm385
Balance		Completed
OutCross		Not Accepted
Sequence Name		C42D8.8
Gene Name		apl-1
Worm Base	Allele Name	tm385 (x1)
	Gene Name	apl-1
	Sequence	C42D8.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		embryonic or larval lethal. Dr. H. Suzuki: mild decrease of chemotaxis to NaCl.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		36526/36527-37172/37173 (646 bp deletion)
Chromosome		X
Putative gene structure		complement(join(34150..34470, 34519..34647, 34700..34898, 34948..35130, 35174..35370, 35424..35633, 35773..35906, 35960..36052, 36189..36422, 36606..36732, 37221..37388, 37849..37914))
Map position		-5.9
Balancer		lon-2 (e678) X
Map position of balancer
Sequence of primers		ExtFwd:GCGGTGGTTGTTGGAGCCTT,ExtRev:TAATTGCAAAGGGGTTTGCG,IntRev:TCGATTCCCACTGACTCGTA,IntFwd:TTCACGTCAAGTTTGGCGCT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Teuscher AC, Statzer C, Goyala A, Domenig SA, Schoen I, Hess M, Hofer AM, Fossati A, Vogel V, Goksel O, Aebersold R, Ewald CY. Longevity interventions modulate mechanotransduction and extracellular matrix homeostasis in C. elegans. Nat Commun 2024 15(1) 276  [ PubMed ID = 38177158 ] [ RRC reference ] Wiese M, Antebi A, Zheng H. Regulation of neuronal APL-1 expression by cholesterol starvation. PLoS One 2012 7(2) e32038  [ PubMed ID = 22363792 ] [ RRC reference ] Wiese M, Antebi A, Zheng H. Intracellular trafficking and synaptic function of APL-1 in Caenorhabditis elegans. PLoS One 2010 5(9)   [ PubMed ID = 20862215 ] [ RRC reference ]