分離済み変異体

tm3821

Allele Nametm3821
BalanceNot Required
OutCrossNot Accepted
Sequence NameM7.3
Gene Namebcc-1
Worm BaseAllele Name tm3821
Gene Name bcc-1
Sequence M7.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: Pvul or rupture at vulva, not Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 8645/8646-T-9162/9163 (517 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(6196..6236, 6318..6417, 6463..6605, 6652..6796, 6843..7029, 7663..7816, 7881..8007, 8062..8196, 8253..8423, 8586..8681, 8723..8762, 9055..9143, 9194..9391, 9441..9516, 9561..9697, 11858..12063, 12460..12553))
Map position4.85
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGGAGAGTCCTCTGGATCT,IntFwd:TGTTAAACTAGGTGGTCCTG,ExtRev:CAGTCAATGTGTCCGTTGAC,IntRev:CATGAAGCTTCCCTGGTATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]

Jones MR, Rose AM, Baillie DL.
The ortholog of the human proto-oncogene ROS1 is required for epithelial development in C. elegans.
Genesis 2013 51(8) 545-61 
[ PubMed ID = 23733356 ] [ RRC reference ]

Jones MR, Rose AM, Baillie DL.
Oligoarray comparative genomic hybridization-mediated mapping of suppressor mutations generated in a deletion-biased mutagenesis screen.
G3 (Bethesda) 2012 2(6) 657-63 
[ PubMed ID = 22690375 ] [ RRC reference ]