| Allele Name | tm3821 |
| Allele Type | 通常株 |
| Sequence Name | M7.3 |
| Gene Name | bcc-1 |
| Worm Base | Allele Name |
tm3821
|
| Gene Name |
bcc-1
|
| Sequence |
M7.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. H. Sawa: Pvul or rupture at vulva, not Psa. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 8645/8646-T-9162/9163 (517 bp deletion + 1 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(6196..6236, 6318..6417, 6463..6605, 6652..6796, 6843..7029, 7663..7816, 7881..8007, 8062..8196, 8253..8423, 8586..8681, 8723..8762, 9055..9143, 9194..9391, 9441..9516, 9561..9697, 11858..12063, 12460..12553)) |
| Map position | 4.85 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GCGGAGAGTCCTCTGGATCT,IntFwd:TGTTAAACTAGGTGGTCCTG,ExtRev:CAGTCAATGTGTCCGTTGAC,IntRev:CATGAAGCTTCCCTGGTATA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45
[ PubMed ID = 24403161 ]
[ RRC reference ]
|
Jones MR, Rose AM, Baillie DL.
The ortholog of the human proto-oncogene ROS1 is required for epithelial development in C. elegans.
Genesis 2013 51(8) 545-61
[ PubMed ID = 23733356 ]
[ RRC reference ]
|
Jones MR, Rose AM, Baillie DL.
Oligoarray comparative genomic hybridization-mediated mapping of suppressor mutations generated in a deletion-biased mutagenesis screen.
G3 (Bethesda) 2012 2(6) 657-63
[ PubMed ID = 22690375 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.