Mutants (Isolated)

tm3790

Allele Nametm3790
Sequence NameY59A8B.22
CGC Namesnx-6
Worm BaseAllele Name tm3790
CGC Name snx-6
Sequence Y59A8B.22
Phenotypehomozygous viable.
Mutation site47394/47395-G-47879/47880 (485 bp deletion + 1 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(39723..39776, 40603..40752, 41848..42063, 43476..43633, 43719..43849, 44904..44994, 45183..45384, 46634..46757, 47436..47557, 47711..47842, 47902..47988, 50263..50526))
Map position13.4
Balancer
Map position of balancer
Sequence of primersExtFwd:ATGGCGTCTCTGATGCGGAA,IntFwd:GGATGAGCGGCAATTCGTTG,ExtRev:CATACGTGTTCCACCTGTGT,IntRev:TCAGCACCGAACCGAGGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dang H, Klokk TI, Schaheen B, McLaughlin BM, Thomas AJ, Durns TA, Bitler BG, Sandvig K, Fares H.
Derlin-dependent retrograde transport from endosomes to the Golgi apparatus.
Traffic 2011 12(10) 1417-31 
[ PubMed ID = 21722281 ] [ RRC reference ]

Norris A, Tammineni P, Wang S, Gerdes J, Murr A, Kwan KY, Cai Q, Grant BD.
SNX-1 and RME-8 oppose the assembly of HGRS-1/ESCRT-0 degradative microdomains on endosomes.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(3) E307-E316 
[ PubMed ID = 28053230 ] [ RRC reference ]

Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van Weering JRT, van Heesbeen RGHP, Middelkoop TC, Basler K, Cullen PJ, Korswagen HC.
A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion.
Nat. Cell Biol. 2011 13(8) 914-923 
[ PubMed ID = 21725319 ] [ RRC reference ]

Chen D, Xiao H, Zhang K, Wang B, Gao Z, Jian Y, Qi X, Sun J, Miao L, Yang C.
Retromer is required for apoptotic cell clearance by phagocytic receptor recycling.
Science 2010 327(5970) 1261-4 
[ PubMed ID = 20133524 ] [ RRC reference ]

Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N.
Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans.
Cell. Mol. Life Sci. 2018 75(11) 2027-2044 
[ PubMed ID = 29196797 ] [ RRC reference ]

Oikonomou G, Perens EA, Lu Y, Shaham S.
Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments.
Dev. Biol. 2012 362(1) 42-9 
[ PubMed ID = 22138055 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol. Biol. Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]