Home > Mutants (Isolated) > tm3790

Mutants (Isolated)

Allele Name		tm3790
Allele Type		Normal
Sequence Name		Y59A8B.22
Gene Name		snx-6
Worm Base	Allele Name	tm3790
	Gene Name	snx-6
	Sequence	Y59A8B.22
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		47394/47395-G-47879/47880 (485 bp deletion + 1 bp insertion)
Chromosome		V
Putative gene structure		complement(join(39723..39776, 40603..40752, 41848..42063, 43476..43633, 43719..43849, 44904..44994, 45183..45384, 46634..46757, 47436..47557, 47711..47842, 47902..47988, 50263..50526))
Map position		13.4
Balancer
Map position of balancer
Sequence of primers		ExtFwd:ATGGCGTCTCTGATGCGGAA,IntFwd:GGATGAGCGGCAATTCGTTG,ExtRev:CATACGTGTTCCACCTGTGT,IntRev:TCAGCACCGAACCGAGGAGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Norris A, Tammineni P, Wang S, Gerdes J, Murr A, Kwan KY, Cai Q, Grant BD. SNX-1 and RME-8 oppose the assembly of HGRS-1/ESCRT-0 degradative microdomains on endosomes. Proc Natl Acad Sci U S A 2017 114(3) E307-E316  [ PubMed ID = 28053230 ] [ RRC reference ] Vieira N, Bessa C, Rodrigues AJ, Marques P, Chan FY, de Carvalho AX, Correia-Neves M, Sousa N. Sorting nexin 3 mutation impairs development and neuronal function in Caenorhabditis elegans. Cell Mol Life Sci 2018 75(11) 2027-2044  [ PubMed ID = 29196797 ] [ RRC reference ] Chen D, Xiao H, Zhang K, Wang B, Gao Z, Jian Y, Qi X, Sun J, Miao L, Yang C. Retromer is required for apoptotic cell clearance by phagocytic receptor recycling. Science 2010 327(5970) 1261-4  [ PubMed ID = 20133524 ] [ RRC reference ] Oikonomou G, Perens EA, Lu Y, Shaham S. Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments. Dev Biol 2012 362(1) 42-9  [ PubMed ID = 22138055 ] [ RRC reference ] Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van Weering JRT, van Heesbeen RGHP, Middelkoop TC, Basler K, Cullen PJ, Korswagen HC. A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion. Nat Cell Biol 2011 13(8) 914-923  [ PubMed ID = 21725319 ] [ RRC reference ] Dang H, Klokk TI, Schaheen B, McLaughlin BM, Thomas AJ, Durns TA, Bitler BG, Sandvig K, Fares H. Derlin-dependent retrograde transport from endosomes to the Golgi apparatus. Traffic 2011 12(10) 1417-31  [ PubMed ID = 21722281 ] [ RRC reference ] Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z. Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling. Mol Biol Cell 2011 22(3) 354-74  [ PubMed ID = 21148288 ] [ RRC reference ]