分離済み変異体

tm3737

Allele Nametm3737
BalanceNot Required
OutCrossNot Accepted
Sequence NameF22F4.3
Gene Nameklp-13
Worm BaseAllele Name tm3737
Gene Name klp-13
Sequence F22F4.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Blacque: Dyf(+).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 6627/6628-TGGCTTTTATTTATAAATTCT-7070/7071 (443 bp deletion + 21 bp insertion)
ChromosomeX
Putative gene structurejoin(4805..4831, 6545..6784, 6829..7035, 7455..7548, 8272..8334, 8391..8503, 8547..8655, 9522..9622, 9679..9761, 9808..9945, 10229..10244)
Map position-3.94
Balancer
Map position of balancer
Sequence of primersIntRev:CCCGTCACGAGTATCACTCA,ExtRev:GGACGTGTATGCGAAATGGT,IntFwd:GTAGAGGACATAACGTTGTC,ExtFwd:AGGTCGGAGTTGTACTAGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Turan MG, Kantarci H, Cevik S, Kaplan OI.
ARL13B regulates juxtaposed cilia-cilia elongation in BBSome dependent manner in Caenorhabditis elegans.
iScience 2025 28(2) 111791 
[ PubMed ID = 39925426 ] [ RRC reference ]

Le Cunff Y, Chesneau L, Pastezeur S, Pinson X, Soler N, Fairbrass D, Mercat B, Rodriguez-Garcia R, Alayan Z, Abdouni A, de Neidhardt G, Costes V, Anjubault M, Bouvrais H, Héligon C, Pécréaux J.
Unveiling inter-embryo variability in spindle length over time: Towards quantitative phenotype analysis.
PLoS Comput Biol 2024 20(9) e1012330 
[ PubMed ID = 39236069 ] [ RRC reference ]

Power KM, Nguyen KC, Silva A, Singh S, Hall DH, Rongo C, Barr MM.
NEKL-4 regulates microtubule stability and mitochondrial health in C. elegans ciliated neurons.
bioRxiv 2024   
[ PubMed ID = 38405845 ] [ RRC reference ]

Park K, Li C, Tsiropoulou S, Gonçalves J, Kondratev C, Pelletier L, Blacque OE, Leroux MR.
CDKL kinase regulates the length of the ciliary proximal segment.
Curr Biol 2021 31(11) 2359-2373.e7 
[ PubMed ID = 33857430 ] [ RRC reference ]

Yogev S, Cooper R, Fetter R, Horowitz M, Shen K.
Microtubule Organization Determines Axonal Transport Dynamics.
Neuron 2016 92(2) 449-460 
[ PubMed ID = 27764672 ] [ RRC reference ]