Home > Mutants (Isolated) > tm3719

Mutants (Isolated)

Allele Name		tm3719
Sequence Name		C05C8.6
CGC Name		C05C8.6
Worm Base	Allele Name	tm3719
	CGC Name	C05C8.6
	Sequence	C05C8.6
Phenotype		homozygous viable.
Mutation site		12131/12132-12892/12893 (761 bp deletion)
Chromosome		V
Putative gene structure		complement(join(11003..11436, 11484..11596, 11815..12112, 12161..12946, 12996..13110))
Map position		0.63
Balancer
Map position of balancer
Sequence of primers		ExtRev:CGCCCATCATTCTCCTTGTT,IntRev:AGGTACATGAGCGATAACCA,ExtFwd:CGACAGGCATTGTTTCGGTA,IntFwd:CATGGCTTCGATTCGACTTC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Lyu S, Doroodchi A, Xing H, Sheng Y, DeAndrade MP, Yang Y, Johnson TL, Clemens S, Yokoi F, Miller MA, Xiao R, Li Y. BTBD9 and dopaminergic dysfunction in the pathogenesis of restless legs syndrome. Brain Struct Funct 2020 225(6) 1743-1760  [ PubMed ID = 32468214 ] [ RRC reference ] Chiorazzi M, Rui L, Yang Y, Ceribelli M, Tishbi N, Maurer CW, Ranuncolo SM, Zhao H, Xu W, Chan WC, Jaffe ES, Gascoyne RD, Campo E, Rosenwald A, Ott G, Delabie J, Rimsza LM, Shaham S, Staudt LM. Related F-box proteins control cell death in Caenorhabditis elegans and human lymphoma. Proc Natl Acad Sci U S A 2013 110(10) 3943-8  [ PubMed ID = 23431138 ] [ RRC reference ]