Mutants (Isolated)

tm3673

Allele Nametm3673
BalanceNot Required
OutCrossNot Accepted
Sequence NameY69A2AR.5
Gene NameY69A2AR.5
Worm BaseAllele Name tm3673
Gene Name Y69A2AR.5
Sequence Y69A2AR.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 131033/131034-131220/131221 (187 bp deletion)
ChromosomeIV
Putative gene structurejoin(130286..130369, 130459..130559, 130966..131032, 131077..131198, 131648..131929, 132805..133117)
Map position-6.99
Balancer
Map position of balancer
Sequence of primersExtRev:CTACGAAAACGCTGGATTAC,IntRev:ACGGAGCCTGGGCATGATTA,ExtFwd:CGCGAATTCATTAGGGGTAC,IntFwd:GGGACCCATAAGTGAAGGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Osborne JF, Yanagi KS, Hart AC.
Genetic interactions in a C. elegans sod-1 ALS model: glutamatergic neuron degeneration.
MicroPubl Biol 2021 2021  
[ PubMed ID = 33474528 ] [ RRC reference ]

Saitoh Y, Katane M, Miyamoto T, Sekine M, Sakai-Kato K, Homma H.
d-Serine and d-Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor.
J Neurosci 2020 40(39) 7531-7544 
[ PubMed ID = 32855271 ] [ RRC reference ]

Saitoh Y, Katane M, Kawata T, Maeda K, Sekine M, Furuchi T, Kobuna H, Sakamoto T, Inoue T, Arai H, Nakagawa Y, Homma H.
Spatiotemporal localization of D-amino acid oxidase and D-aspartate oxidases during development in Caenorhabditis elegans.
Mol Cell Biol 2012 32(10) 1967-83 
[ PubMed ID = 22393259 ] [ RRC reference ]