Mutants (Isolated)

tm3655

Allele Nametm3655
BalanceCompleted
OutCrossNot Accepted
Sequence NameF57C9.5
Gene Namehtp-3
Worm BaseAllele Name tm3655 (x1)
Gene Name htp-3
Sequence F57C9.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. B. Meyer: Genes & Dev. 23, 1763 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 6196/6197-6612/6613 (416 bp deletion)
ChromosomeI
Putative gene structurejoin(5256..5312, 5363..5516, 5566..5669, 5714..5826, 5872..6023, 6073..6166, 6214..6398, 6443..6807, 6858..7853)
Map position-0.72
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:GGGTCTCGACACGAGAACAC,IntFwd:GACCTGAGTTACGGTAAACT,ExtRev:CGGGAGAGGTGATAATAGCA,IntRev:TCGACTTCAACTGGAGGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gordon SG, Rodriguez AA, Gu Y, Corbett KD, Lee CF, Rog O.
The synaptonemal complex aligns meiotic chromosomes by wetting.
Sci Adv 2025 11(9) eadt5675 
[ PubMed ID = 40009663 ] [ RRC reference ]

Köhler S, Wojcik M, Xu K, Dernburg AF.
Dynamic molecular architecture of the synaptonemal complex.
Sci Adv 2025 11(4) eadq9374 
[ PubMed ID = 39841849 ] [ RRC reference ]

Zhang R, Liu B, Tian Y, Xin M, Li Q, Huang X, Liu Y, Zhao L, Qi F, Wang R, Meng X, Chen J, Zhou J, Gao J.
A chromosome-coupled ubiquitin-proteasome pathway is required for meiotic surveillance.
Cell Death Differ 2024 31(12) 1730-1745 
[ PubMed ID = 39237708 ] [ RRC reference ]

Gordon SG, Rodriguez AA, Gu Y, Corbett KD, Lee CF, Rog O.
The synaptonemal complex aligns meiotic chromosomes by wetting.
bioRxiv 2024   
[ PubMed ID = 39149313 ] [ RRC reference ]

Blundon JM, Cesar BI, Bae JW, Čavka I, Haversat J, Ries J, Köhler S, Kim Y.
Skp1 proteins are structural components of the synaptonemal complex in C. elegans.
Sci Adv 2024 10(7) eadl4876 
[ PubMed ID = 38354250 ] [ RRC reference ]

Wang R, Li J, Tian Y, Sun Y, Zhang Y, Liu M, Zhang R, Zhao L, Li Q, Meng X, Zhou J, Gao J.
The dynamic recruitment of LAB proteins senses meiotic chromosome axis differentiation in C. elegans.
J Cell Biol 2024 223(2)  
[ PubMed ID = 38010234 ] [ RRC reference ]

Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A.
Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans.
Aging Cell 2022 21(11) e13716 
[ PubMed ID = 36176234 ] [ RRC reference ]

Guo H, Stamper EL, Sato-Carlton A, Shimazoe MA, Li X, Zhang L, Stevens L, Tam KCJ, Dernburg AF, Carlton PM.
Phosphoregulation of DSB-1 mediates control of meiotic double-strand break activity.
Elife 2022 11  
[ PubMed ID = 35758641 ] [ RRC reference ]

Das D, Trivedi S, Blazícková J, Arur S, Silva N.
Phosphorylation of HORMA-domain protein HTP-3 at Serine 285 is dispensable for crossover formation.
G3 (Bethesda) 2022 12(5)  
[ PubMed ID = 35389463 ] [ RRC reference ]

Woglar A, Yamaya K, Roelens B, Boettiger A, Köhler S, Villeneuve AM.
Quantitative cytogenetics reveals molecular stoichiometry and longitudinal organization of meiotic chromosome axes and loops.
PLoS Biol 2020 18(8) e3000817 
[ PubMed ID = 32813728 ] [ RRC reference ]

Alleva B, Clausen S, Koury E, Hefel A, Smolikove S.
CRL4 regulates recombination and synaptonemal complex aggregation in the Caenorhabditis elegans germline.
PLoS Genet 2019 15(11) e1008486 
[ PubMed ID = 31738749 ] [ RRC reference ]

Cahoon CK, Helm JM, Libuda DE.
Synaptonemal Complex Central Region Proteins Promote Localization of Pro-crossover Factors to Recombination Events During Caenorhabditis elegans Meiosis.
Genetics 2019 213(2) 395-409 
[ PubMed ID = 31431470 ] [ RRC reference ]

Köhler S, Wojcik M, Xu K, Dernburg AF.
Superresolution microscopy reveals the three-dimensional organization of meiotic chromosome axes in intact Caenorhabditis elegans tissue.
Proc Natl Acad Sci U S A 2017 114(24) E4734-E4743 
[ PubMed ID = 28559338 ] [ RRC reference ]

Rog O, Köhler S, Dernburg AF.
The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors.
Elife 2017 6  
[ PubMed ID = 28045371 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997 
[ PubMed ID = 27605049 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev Cell 2015 35(2) 247-61 
[ PubMed ID = 26506311 ] [ RRC reference ]

Kim Y, Rosenberg SC, Kugel CL, Kostow N, Rog O, Davydov V, Su TY, Dernburg AF, Corbett KD.
The chromosome axis controls meiotic events through a hierarchical assembly of HORMA domain proteins.
Dev Cell 2014 31(4) 487-502 
[ PubMed ID = 25446517 ] [ RRC reference ]

Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet 2013 9(8) e1003679 
[ PubMed ID = 23990794 ] [ RRC reference ]

Tzur YB, Egydio de Carvalho C, Nadarajan S, Van Bostelen I, Gu Y, Chu DS, Cheeseman IM, Colaiácovo MP.
LAB-1 targets PP1 and restricts Aurora B kinase upon entrance into meiosis to promote sister chromatid cohesion.
PLoS Biol 2012 10(8) e1001378 
[ PubMed ID = 22927794 ] [ RRC reference ]

Labella S, Woglar A, Jantsch V, Zetka M.
Polo kinases establish links between meiotic chromosomes and cytoskeletal forces essential for homolog pairing.
Dev Cell 2011 21(5) 948-58 
[ PubMed ID = 22018921 ] [ RRC reference ]