Mutants (Isolated)

tm3655

Allele Name

tm3655

Allele Type

Balanced

Sequence Name

F57C9.5

Gene Name

htp-3

Worm Base

Allele Name

tm3655

Gene Name

htp-3

Sequence

F57C9.5

Phenotype

lethal or sterile. Dr. B. Meyer: Genes & Dev. 23, 1763 (2009).

Mutation site

6196/6197-6612/6613 (416 bp deletion)

Chromosome

Putative gene structure

join(5256..5312, 5363..5516, 5566..5669, 5714..5826, 5872..6023, 6073..6166, 6214..6398, 6443..6807, 6858..7853)

Map position

-0.72

Balancer

hT2 [bli-4(e937) let-? qIs48]

Map position of balancer

Sequence of primers

ExtFwd:GGGTCTCGACACGAGAACAC,IntFwd:GACCTGAGTTACGGTAAACT,ExtRev:CGGGAGAGGTGATAATAGCA,IntRev:TCGACTTCAACTGGAGGTAC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Wang R, Li J, Tian Y, Sun Y, Zhang Y, Liu M, Zhang R, Zhao L, Li Q, Meng X, Zhou J, Gao J.
The dynamic recruitment of LAB proteins senses meiotic chromosome axis differentiation in C. elegans.
J Cell Biol 2024 223(2)
[ PubMed ID = 38010234 ] [ RRC reference ]

Blundon JM, Cesar BI, Bae JW, Čavka I, Haversat J, Ries J, Köhler S, Kim Y.
Skp1 proteins are structural components of the synaptonemal complex in C. elegans.
Sci Adv 2024 10(7) eadl4876
[ PubMed ID = 38354250 ] [ RRC reference ]

Loose JA, Amrit FRG, Patil T, Yanowitz JL, Ghazi A.
Meiotic dysfunction accelerates somatic aging in Caenorhabditis elegans.
Aging Cell 2022 21(11) e13716
[ PubMed ID = 36176234 ] [ RRC reference ]

Guo H, Stamper EL, Sato-Carlton A, Shimazoe MA, Li X, Zhang L, Stevens L, Tam KCJ, Dernburg AF, Carlton PM.
Phosphoregulation of DSB-1 mediates control of meiotic double-strand break activity.
Elife 2022 11
[ PubMed ID = 35758641 ] [ RRC reference ]

Das D, Trivedi S, Blazícková J, Arur S, Silva N.
Phosphorylation of HORMA-domain protein HTP-3 at Serine 285 is dispensable for crossover formation.
G3 (Bethesda) 2022 12(5)
[ PubMed ID = 35389463 ] [ RRC reference ]

Woglar A, Yamaya K, Roelens B, Boettiger A, Köhler S, Villeneuve AM.
Quantitative cytogenetics reveals molecular stoichiometry and longitudinal organization of meiotic chromosome axes and loops.
PLoS Biol 2020 18(8) e3000817
[ PubMed ID = 32813728 ] [ RRC reference ]

Cahoon CK, Helm JM, Libuda DE.
Synaptonemal Complex Central Region Proteins Promote Localization of Pro-crossover Factors to Recombination Events During Caenorhabditis elegans Meiosis.
Genetics 2019 213(2) 395-409
[ PubMed ID = 31431470 ] [ RRC reference ]

Alleva B, Clausen S, Koury E, Hefel A, Smolikove S.
CRL4 regulates recombination and synaptonemal complex aggregation in the Caenorhabditis elegans germline.
PLoS Genet 2019 15(11) e1008486
[ PubMed ID = 31738749 ] [ RRC reference ]

Rog O, Köhler S, Dernburg AF.
The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors.
Elife 2017 6
[ PubMed ID = 28045371 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997
[ PubMed ID = 27605049 ] [ RRC reference ]

Köhler S, Wojcik M, Xu K, Dernburg AF.
Superresolution microscopy reveals the three-dimensional organization of meiotic chromosome axes in intact Caenorhabditis elegans tissue.
Proc Natl Acad Sci U S A 2017 114(24) E4734-E4743
[ PubMed ID = 28559338 ] [ RRC reference ]

Couteau F, Zetka M.
DNA damage during meiosis induces chromatin remodeling and synaptonemal complex disassembly.
Dev Cell 2011 20(3) 353-63
[ PubMed ID = 21397846 ] [ RRC reference ]

Tzur YB, Egydio de Carvalho C, Nadarajan S, Van Bostelen I, Gu Y, Chu DS, Cheeseman IM, Colaiácovo MP.
LAB-1 targets PP1 and restricts Aurora B kinase upon entrance into meiosis to promote sister chromatid cohesion.
PLoS Biol 2012 10(8) e1001378
[ PubMed ID = 22927794 ] [ RRC reference ]

Labella S, Woglar A, Jantsch V, Zetka M.
Polo kinases establish links between meiotic chromosomes and cytoskeletal forces essential for homolog pairing.
Dev Cell 2011 21(5) 948-58
[ PubMed ID = 22018921 ] [ RRC reference ]

Kim Y, Rosenberg SC, Kugel CL, Kostow N, Rog O, Davydov V, Su TY, Dernburg AF, Corbett KD.
The chromosome axis controls meiotic events through a hierarchical assembly of HORMA domain proteins.
Dev Cell 2014 31(4) 487-502
[ PubMed ID = 25446517 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev Cell 2015 35(2) 247-61
[ PubMed ID = 26506311 ] [ RRC reference ]

Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet 2013 9(8) e1003679
[ PubMed ID = 23990794 ] [ RRC reference ]

Severson AF, Ling L, van Zuylen V, Meyer BJ.
The axial element protein HTP-3 promotes cohesin loading and meiotic axis assembly in C. elegans to implement the meiotic program of chromosome segregation.
Genes Dev 2009 23(15) 1763-78
[ PubMed ID = 19574299 ] [ RRC reference ]