Mutants (Isolated)

tm3655

Allele Nametm3655
Sequence NameF57C9.5
CGC Namehtp-3
Worm BaseAllele Name tm3655
CGC Name htp-3
Sequence F57C9.5
Phenotypelethal or sterile. Dr. B. Meyer: Genes & Dev. 23, 1763 (2009).
Mutation site6196/6197-6612/6613 (416 bp deletion)
ChromosomeI
Putative gene structurejoin(5256..5312, 5363..5516, 5566..5669, 5714..5826, 5872..6023, 6073..6166, 6214..6398, 6443..6807, 6858..7853)
Map position-0.72
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:GGGTCTCGACACGAGAACAC,IntFwd:GACCTGAGTTACGGTAAACT,ExtRev:CGGGAGAGGTGATAATAGCA,IntRev:TCGACTTCAACTGGAGGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cahoon CK, Helm JM, Libuda DE.
Synaptonemal Complex Central Region Proteins Promote Localization of Pro-crossover Factors to Recombination Events During Caenorhabditis elegans Meiosis.
Genetics 2019 213(2) 395-409 
[ PubMed ID = 31431470 ] [ RRC reference ]

Köhler S, Wojcik M, Xu K, Dernburg AF.
Superresolution microscopy reveals the three-dimensional organization of meiotic chromosome axes in intact Caenorhabditis elegans tissue.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(24) E4734-E4743 
[ PubMed ID = 28559338 ] [ RRC reference ]

Alleva B, Clausen S, Koury E, Hefel A, Smolikove S.
CRL4 regulates recombination and synaptonemal complex aggregation in the Caenorhabditis elegans germline.
PLoS Genet. 2019 15(11) e1008486 
[ PubMed ID = 31738749 ] [ RRC reference ]

Kim Y, Rosenberg SC, Kugel CL, Kostow N, Rog O, Davydov V, Su TY, Dernburg AF, Corbett KD.
The chromosome axis controls meiotic events through a hierarchical assembly of HORMA domain proteins.
Dev. Cell 2014 31(4) 487-502 
[ PubMed ID = 25446517 ] [ RRC reference ]

Couteau F, Zetka M.
DNA damage during meiosis induces chromatin remodeling and synaptonemal complex disassembly.
Dev. Cell 2011 20(3) 353-63 
[ PubMed ID = 21397846 ] [ RRC reference ]

Labella S, Woglar A, Jantsch V, Zetka M.
Polo kinases establish links between meiotic chromosomes and cytoskeletal forces essential for homolog pairing.
Dev. Cell 2011 21(5) 948-58 
[ PubMed ID = 22018921 ] [ RRC reference ]

Rog O, Köhler S, Dernburg AF.
The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors.
Elife 2017 6  
[ PubMed ID = 28045371 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997 
[ PubMed ID = 27605049 ] [ RRC reference ]

Tzur YB, Egydio de Carvalho C, Nadarajan S, Van Bostelen I, Gu Y, Chu DS, Cheeseman IM, Colaiácovo MP.
LAB-1 targets PP1 and restricts Aurora B kinase upon entrance into meiosis to promote sister chromatid cohesion.
PLoS Biol. 2012 10(8) e1001378 
[ PubMed ID = 22927794 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev. Cell 2015 35(2) 247-61 
[ PubMed ID = 26506311 ] [ RRC reference ]

Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet. 2013 9(8) e1003679 
[ PubMed ID = 23990794 ] [ RRC reference ]

Severson AF, Ling L, van Zuylen V, Meyer BJ.
The axial element protein HTP-3 promotes cohesin loading and meiotic axis assembly in C. elegans to implement the meiotic program of chromosome segregation.
Genes Dev. 2009 23(15) 1763-78 
[ PubMed ID = 19574299 ] [ RRC reference ]