Mutants (Isolated)

tm3647

Allele Nametm3647
Sequence NameY71H2AM.17
CGC NameY71H2AM.17
Worm BaseAllele Name tm3647
CGC Name Y71H2AM.17
Sequence Y71H2AM.17
Phenotypehomozygous viable. Dr. H. Sawa: non Psa.
Mutation site76985/76986-AAA-77417/77418 (432 bp deletion + 3 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(73322..73539, 74803..75005, 75640..75675, 75825..75913, 76685..76876, 76926..76991, 77037..77243, 77296..77337))
Map position-11.17
Balancer
Map position of balancer
Sequence of primersIntRev:CCCACTGGACATTGAGGGGA,IntFwd:TAACGATGCTCGGCGAGAAC,ExtRev:CACGTGCCAGGCTTGCCAAA,ExtFwd:CATTCGGTGGTGTGGAACTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Flibotte S, Kim BR, Van de Laar E, Brown L, Moghal N.
The SWI/SNF chromatin remodeling complex exerts both negative and positive control over LET-23/EGFR-dependent vulval induction in Caenorhabditis elegans.
Dev Biol 2016 415(1) 46-63 
[ PubMed ID = 27207389 ] [ RRC reference ]

Riedel CG, Dowen RH, Lourenco GF, Kirienko NV, Heimbucher T, West JA, Bowman SK, Kingston RE, Dillin A, Asara JM, Ruvkun G.
DAF-16 employs the chromatin remodeller SWI/SNF to promote stress resistance and longevity.
Nat Cell Biol 2013 15(5) 491-501 
[ PubMed ID = 23604319 ] [ RRC reference ]

Mathies LD, Blackwell GG, Austin MK, Edwards AC, Riley BP, Davies AG, Bettinger JC.
SWI/SNF chromatin remodeling regulates alcohol response behaviors in Caenorhabditis elegans and is associated with alcohol dependence in humans.
Proc Natl Acad Sci U S A 2015 112(10) 3032-7 
[ PubMed ID = 25713357 ] [ RRC reference ]

Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]