Mutants (Isolated)

tm3574

Allele Nametm3574
Sequence NameC46F11.2
CGC Namegsr-1
Worm BaseAllele Name tm3574
CGC Name gsr-1
Sequence C46F11.2
Phenotypelethal or sterile.
Mutation site9752/9753-10135/10136 (383 bp deletion)
ChromosomeIII
Putative gene structurejoin(9164..9411, 9467..9824, 9875..10346, 10403..10704)
Map position-5
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:TCCGGGACCACGCTGATTAC,IntRev:TATACCTTCCGTGAGTCCGA,IntFwd:CGGATTTGATGTGACGCTTA,ExtRev:CCGTACTTTTCAACGGCCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mora-Lorca JA, Sáenz-Narciso B, Gaffney CJ, Naranjo-Galindo FJ, Pedrajas JR, Guerrero-Gómez D, Dobrzynska A, Askjaer P, Szewczyk NJ, Cabello J, Miranda-Vizuete A.
Glutathione reductase gsr-1 is an essential gene required for Caenorhabditis elegans early embryonic development.
Free Radic. Biol. Med. 2016 96 446-61 
[ PubMed ID = 27117030 ] [ RRC reference ]

Lüersen K, Stegehake D, Daniel J, Drescher M, Ajonina I, Ajonina C, Hertel P, Woltersdorf C, Liebau E.
The glutathione reductase GSR-1 determines stress tolerance and longevity in Caenorhabditis elegans.
PLoS ONE 2013 8(4) e60731 
[ PubMed ID = 23593298 ] [ RRC reference ]