Mutants (Isolated)

tm3574

Allele Nametm3574
BalanceCompleted
OutCrossNot Accepted
Sequence NameC46F11.2
Gene Namegsr-1
Worm BaseAllele Name tm3574 (x1)
Gene Name gsr-1
Sequence C46F11.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 9752/9753-10135/10136 (383 bp deletion)
ChromosomeIII
Putative gene structurejoin(9164..9411, 9467..9824, 9875..10346, 10403..10704)
Map position-5
Balancer,qC1[nIs281]
Map position of balancer
Sequence of primersExtFwd:TCCGGGACCACGCTGATTAC,IntRev:TATACCTTCCGTGAGTCCGA,IntFwd:CGGATTTGATGTGACGCTTA,ExtRev:CCGTACTTTTCAACGGCCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Valenzuela-Villatoro M, Gómez-Orte E, Guerrero-Gómez D, Cheng Q, Zheleva A, Mora-Lorca JA, Petrovic D, O Neil NJ, Cerón J, Hatakeyama A, Onami S, Ordóñez-Luque A, Ayuso C, Askjaer P, Filipovic MR, Arnér ESJ, Cabello J, Miranda-Vizuete A.
The transsulfuration pathway suppresses the embryonic lethal phenotype of glutathione reductase mutants in Caenorhabditis elegans.
G3 (Bethesda) 2025 15(8)  
[ PubMed ID = 40333285 ] [ RRC reference ]

Mora-Lorca JA, Sáenz-Narciso B, Gaffney CJ, Naranjo-Galindo FJ, Pedrajas JR, Guerrero-Gómez D, Dobrzynska A, Askjaer P, Szewczyk NJ, Cabello J, Miranda-Vizuete A.
Glutathione reductase gsr-1 is an essential gene required for Caenorhabditis elegans early embryonic development.
Free Radic Biol Med 2016 96 446-61 
[ PubMed ID = 27117030 ] [ RRC reference ]

Lüersen K, Stegehake D, Daniel J, Drescher M, Ajonina I, Ajonina C, Hertel P, Woltersdorf C, Liebau E.
The glutathione reductase GSR-1 determines stress tolerance and longevity in Caenorhabditis elegans.
PLoS One 2013 8(4) e60731 
[ PubMed ID = 23593298 ] [ RRC reference ]