| Allele Name | tm3573 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | R06F6.9 |
| Gene Name | ech-4 |
| Worm Base | Allele Name |
tm3573
|
| Gene Name |
ech-4
|
| Sequence |
R06F6.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 36373/36374-36553/36554 (180 bp deletion) |
| Chromosome | II |
| Putative gene structure | join(35794..35846,35895..36501,36547..37044) |
| Map position | 3.13 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GCGGAAGTTGGGAGAACGCT,ExtFwd:TCCGCAAGTGTAAGTCTGCA,IntFwd:TTCGCTCGTTCTCTGCCCAG,ExtRev:GCCTCGATATTGTTGACCTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Elle IC, Simonsen KT, Olsen LC, Birck PK, Ehmsen S, Tuck S, Le TT, Færgeman NJ.
Tissue- and paralogue-specific functions of acyl-CoA-binding proteins in lipid metabolism in Caenorhabditis elegans.
Biochem J 2011 437(2) 231-41
[ PubMed ID = 21539519 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.