Mutants (Isolated)

tm3565

Allele Nametm3565
Allele TypeNormal
Sequence NameC33C12.9
Gene NameC33C12.9
Worm BaseAllele Name tm3565
Gene Name C33C12.9
Sequence C33C12.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27314/27315-TTTCTT-27920/27921 (606 bp deletion + 6 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(26570..26899, 27727..27951, 28701..28811, 29067..29105))
Map position-13.63
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGACCGCAACGCACGTTAA,ExtRev:GCCGTATTTGAATTCCCTGT,IntFwd:GGGTTTTTGACCGAATCTAG,IntRev:AGGAAATCCGATCTCGCGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]