Mutants (Isolated)

tm3565

Allele Nametm3565
Sequence NameC33C12.9
CGC NameC33C12.9
Worm BaseAllele Name tm3565
CGC Name C33C12.9
Sequence C33C12.9
Phenotypehomozygous viable.
Mutation site27314/27315-TTTCTT-27920/27921 (606 bp deletion + 6 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(26570..26899, 27727..27951, 28701..28811, 29067..29105))
Map position-13.63
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGACCGCAACGCACGTTAA,ExtRev:GCCGTATTTGAATTCCCTGT,IntFwd:GGGTTTTTGACCGAATCTAG,IntRev:AGGAAATCCGATCTCGCGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]