Mutants (Isolated)

tm355

Allele Nametm355
Sequence NameF45H11.4
CGC Namemgl-2
Worm BaseAllele Name tm355
CGC Name mgl-2
Sequence F45H11.4
Phenotypehomozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. I. Mori: normal thermotaxis. Dr. K. Ashrafi: normal Sudan Black B staining. Dr. M. Chalfie: normal touch sensitivity. Dr. L. Avery: Genes & Dev. 23, 12 (2009)
Mutation site28272/28273-28543/28544 (271 bp deletion)
ChromosomeI
Putative gene structurejoin(complement(22543..22752, 23244..23384, 23472..23674,23854..23923, 24705..24917, 24970. .25142, 25259..25362, 25592..25894, 25938..25994, 26042..26298, 26642..27154, 27407..27593, 27875..28009, 28059..28229, 28502..28949, 29654..29825, 29876..30053, 30102..30256 Z78418:432..545)
Map position4.97
Balancer
Map position of balancer
Sequence of primersExtFwd:TTTGGCCATGAGCCAAGAGT,IntFwd:AGCAACACGCCATTGTTTCT,IntRev:CGGATTGTCTGGCATATACA,ExtRev:ATTCAGCAGGTAAATCTCCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hyde R, Corkins ME, Somers GA, Hart AC.
PKC-1 acts with the ERK MAPK signaling pathway to regulate Caenorhabditis elegans mechanosensory response.
Genes Brain Behav. 2011 10(3) 286-98 
[ PubMed ID = 21143768 ] [ RRC reference ]

Kang C, Avery L.
Systemic regulation of starvation response in Caenorhabditis elegans.
Genes Dev. 2009 23(1) 12-7 
[ PubMed ID = 19136622 ] [ RRC reference ]

Jeong H, Paik YK.
MGL-1 on AIY neurons translates starvation to reproductive plasticity via neuropeptide signaling in Caenorhabditis elegans.
Dev. Biol. 2017 430(1) 80-89 
[ PubMed ID = 28807780 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab. 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]

Lemieux GA, Keiser MJ, Sassano MF, Laggner C, Mayer F, Bainton RJ, Werb Z, Roth BL, Shoichet BK, Ashrafi K.
In silico molecular comparisons of C. elegans and mammalian pharmacology identify distinct targets that regulate feeding.
PLoS Biol. 2013 11(11) e1001712 
[ PubMed ID = 24260022 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr. Biol. 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J. Neurosci. 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]