Home > Mutants (Isolated) > tm3536

Mutants (Isolated)

Allele Name		tm3536
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F14F3.3
Gene Name		mboa-7
Worm Base	Allele Name	tm3536
	Gene Name	mboa-7
	Sequence	F14F3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		28455/28456-28799/28800 (345 bp deletion)
Chromosome		X
Putative gene structure		complement(join(26703..26886, 27481..27585, 27632..27792, 27840..28014, 28060..28154, 28201..28349, 28466..28604, 28855..28984, 29031..29100, 29143..29296))
Map position		2.22
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GTCGTTTCTTGTGACGTAGC,IntFwd:TGCGGAACCACTTTGGACGA,ExtRev:TGCGTCCGCAAACACGTCAG,IntRev:GCTGCGTGTTGACGCGTTTC
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Rawsthorne H, Calahorro F, Holden-Dye L, O' Connor V, Dillon J. Investigating autism associated genes in C. elegans reveals candidates with a role in social behaviour. PLoS One 2021 16(5) e0243121  [ PubMed ID = 34043629 ] [ RRC reference ] Lee HC, Kubo T, Kono N, Kage-Nakadai E, Gengyo-Ando K, Mitani S, Inoue T, Arai H. Depletion of mboa-7, an enzyme that incorporates polyunsaturated fatty acids into phosphatidylinositol (PI), impairs PI 3-phosphate signaling in Caenorhabditis elegans. Genes Cells 2012 17(9) 748-57  [ PubMed ID = 22862955 ] [ RRC reference ]