Mutants (Isolated)

tm3536

Allele Nametm3536
Sequence NameF14F3.3
CGC Namemboa-7
Worm BaseAllele Name tm3536
CGC Name mboa-7
Sequence F14F3.3
Phenotypehomozygous viable.
Mutation site28455/28456-28799/28800 (345 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(26703..26886, 27481..27585, 27632..27792, 27840..28014, 28060..28154, 28201..28349, 28466..28604, 28855..28984, 29031..29100, 29143..29296))
Map position2.22
Balancer
Map position of balancer
Sequence of primersExtFwd:GTCGTTTCTTGTGACGTAGC,IntFwd:TGCGGAACCACTTTGGACGA,ExtRev:TGCGTCCGCAAACACGTCAG,IntRev:GCTGCGTGTTGACGCGTTTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lee HC, Kubo T, Kono N, Kage-Nakadai E, Gengyo-Ando K, Mitani S, Inoue T, Arai H.
Depletion of mboa-7, an enzyme that incorporates polyunsaturated fatty acids into phosphatidylinositol (PI), impairs PI 3-phosphate signaling in Caenorhabditis elegans.
Genes Cells 2012 17(9) 748-57 
[ PubMed ID = 22862955 ] [ RRC reference ]