分離済み変異体

tm3536

Allele Nametm3536
BalanceNot Required
OutCrossNot Accepted
Sequence NameF14F3.3
Gene Namemboa-7
Worm BaseAllele Name tm3536
Gene Name mboa-7
Sequence F14F3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28455/28456-28799/28800 (345 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(26703..26886, 27481..27585, 27632..27792, 27840..28014, 28060..28154, 28201..28349, 28466..28604, 28855..28984, 29031..29100, 29143..29296))
Map position2.22
Balancer
Map position of balancer
Sequence of primersExtFwd:GTCGTTTCTTGTGACGTAGC,IntFwd:TGCGGAACCACTTTGGACGA,ExtRev:TGCGTCCGCAAACACGTCAG,IntRev:GCTGCGTGTTGACGCGTTTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Rawsthorne H, Calahorro F, Holden-Dye L, O' Connor V, Dillon J.
Investigating autism associated genes in C. elegans reveals candidates with a role in social behaviour.
PLoS One 2021 16(5) e0243121 
[ PubMed ID = 34043629 ] [ RRC reference ]

Lee HC, Kubo T, Kono N, Kage-Nakadai E, Gengyo-Ando K, Mitani S, Inoue T, Arai H.
Depletion of mboa-7, an enzyme that incorporates polyunsaturated fatty acids into phosphatidylinositol (PI), impairs PI 3-phosphate signaling in Caenorhabditis elegans.
Genes Cells 2012 17(9) 748-57 
[ PubMed ID = 22862955 ] [ RRC reference ]