Home > 分離済み変異体 > tm3524

分離済み変異体

Allele Name		tm3524
Allele Type		通常株
Sequence Name		C16E9.4
Gene Name		inx-1
Worm Base	Allele Name	tm3524
	Gene Name	inx-1
	Sequence	C16E9.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. C. Hunter: normal growth and developement at 20C. Dr. C-F. Chuang: normal AWC signaling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		14424/14425-14662/14663 (238 bp deletion)
Chromosome		X
Putative gene structure		complement(join(10133..11266, 12265..12353, 14171..14269, 14315..14413, 14470..14637, 14682..14918, 14967..15091, 15448..15557, 15604..15739, 15808..15964, 17792..17911, 22717..22792))
Map position		-1.93
Balancer
Map position of balancer
Sequence of primers		ExtFwd:TCGTCGGCCACTCATTTGAC,IntFwd:CTTATTCGATCTGTCGTGGT,ExtRev:GGCCTTGATCATGAAAGCTG,IntRev:TGTGTTCGGAACGCAGCGTG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Almoril-Porras A, Calvo AC, Niu L, Beagan J, Díaz García M, Hawk JD, Aljobeh A, Wisdom EM, Ren I, Wang ZW, Colón-Ramos DA. Configuration of electrical synapses filters sensory information to drive behavioral choices. Cell 2025 188(1) 89-103.e13  [ PubMed ID = 39742807 ] [ RRC reference ] Kramer TS, Wan FK, Pugliese SM, Atanas AA, Hiser AW, Luo J, Bueno E, Flavell SW. Neural Sequences Underlying Directed Turning in C. elegans. bioRxiv 2024    [ PubMed ID = 39149398 ] [ RRC reference ] Nakayama A, Watanabe M, Yamashiro R, Kuroyanagi H, Matsuyama HJ, Oshima A, Mori I, Nakano S. A hyperpolarizing neuron recruits undocked innexin hemichannels to transmit neural information in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2024 121(21) e2406565121  [ PubMed ID = 38753507 ] [ RRC reference ] Choi U, Hu M, Zhang Q, Sieburth D. The head mesodermal cell couples FMRFamide neuropeptide signaling with rhythmic muscle contraction in C. elegans. Nat Commun 2023 14(1) 4218  [ PubMed ID = 37452027 ] [ RRC reference ] Almoril-Porras A, Calvo AC, Niu L, Beagan J, Hawk JD, Aljobeh A, Wisdom EM, Ren I, Díaz-García M, Wang ZW, Colón-Ramos DA. Specific configurations of electrical synapses filter sensory information to drive choices in behavior. bioRxiv 2023    [ PubMed ID = 37577611 ] [ RRC reference ] Zhan X, Chen C, Niu L, Du X, Lei Y, Dan R, Wang ZW, Liu P. Locomotion modulates olfactory learning through proprioception in C. elegans. Nat Commun 2023 14(1) 4534  [ PubMed ID = 37500635 ] [ RRC reference ] Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H. A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway. Front Immunol 2023 14 1249436  [ PubMed ID = 37928537 ] [ RRC reference ] Jiang J, Su Y, Zhang R, Li H, Tao L, Liu Q. C. elegans enteric motor neurons fire synchronized action potentials underlying the defecation motor program. Nat Commun 2022 13(1) 2783  [ PubMed ID = 35589790 ] [ RRC reference ] Choi U, Wang H, Hu M, Kim S, Sieburth D. Presynaptic coupling by electrical synapses coordinates a rhythmic behavior by synchronizing the activities of a neuron pair. Proc Natl Acad Sci U S A 2021 118(20)   [ PubMed ID = 33972428 ] [ RRC reference ] Hori S, Oda S, Suehiro Y, Iino Y, Mitani S. OFF-responses of interneurons optimize avoidance behaviors depending on stimulus strength via electrical synapses. PLoS Genet 2018 14(6) e1007477  [ PubMed ID = 29939997 ] [ RRC reference ] Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI. Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272  [ PubMed ID = 28143932 ] [ RRC reference ] Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW. Six innexins contribute to electrical coupling of C. elegans body-wall muscle. PLoS One 2013 8(10) e76877  [ PubMed ID = 24130800 ] [ RRC reference ]