Allele Name | tm3455 |
Allele Type | 通常株 |
Sequence Name | K08F8.1 |
Gene Name | K08F8.1 |
Worm Base | Allele Name |
tm3455
|
Gene Name |
K08F8.1
|
Sequence |
K08F8.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. Y. Jin: no movement defects, grow well. Dr. K. Matsumoto: not hypersensitive to tunicamycin |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 8219/8220-TTGGGTG-8486/8487 (267 bp deletion + 7 bp insertion) |
Chromosome | II |
Putative gene structure | join(6405..6489, 6754..6890, 7525..8026, 8078..8282, 8333..8410, 8631..8755, 8864..9078, 9128..9346) |
Map position | 0.87 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:GTTAGTCATCGGAAGCGTAA,ExtRev:CAGCTCATGAATAGTGAGAC,IntFwd:AGCACCAAATCACCGAGGAC,ExtFwd:CCATCTCGTTCCCGTGTCAC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A. The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans. EMBO Rep 2020 21(3) e48671
[ PubMed ID = 32009302 ]
[ RRC reference ]
|
Matsunaga Y, Qadota H, Furukawa M, Choe HH, Benian GM. Twitchin kinase interacts with MAPKAP kinase 2 in Caenorhabditis elegans striated muscle. Mol Biol Cell 2015 26(11) 2096-111
[ PubMed ID = 25851606 ]
[ RRC reference ]
|
|