Mutants (Isolated)

tm3396

Allele Nametm3396
BalanceNot Required
OutCrossNot Accepted
Sequence NameF08F3.2
Gene Nameacl-6
Worm BaseAllele Name tm3396
Gene Name acl-6
Sequence F08F3.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25289/25290-25740/25741 (451 bp deletion)
ChromosomeV
Putative gene structurejoin(24438..24792, 24849..24943, 24985..25092, 25136..25313, 25848..26177, 26380..26489, 26752..26895, 26949..27147, 27193..27350)
Map position-1.99
Balancer
Map position of balancer
Sequence of primersExtRev:CGATACGATTGTCAGAGCTG,IntRev:ACGTCTCCACCTTCGGCGAT,IntFwd:GTACTCATGGTCAATTCCGC,ExtFwd:GATCCTTCCAGAAAGCCGAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ohba Y, Sakuragi T, Kage-Nakadai E, Tomioka NH, Kono N, Imae R, Inoue A, Aoki J, Ishihara N, Inoue T, Mitani S, Arai H.
Mitochondria-type GPAT is required for mitochondrial fusion.
EMBO J 2013 32(9) 1265-79 
[ PubMed ID = 23572076 ] [ RRC reference ]