| Allele Name | tm333 |
| Allele Type | 通常株 |
| Sequence Name | DH11.3 |
| Gene Name | pgp-11 |
| Worm Base | Allele Name |
tm333
|
| Gene Name |
pgp-11
|
| Sequence |
DH11.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 17690/17691-18143/18144 (453 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(15249..15357, 15406..15641, 15803..16003, 16052..16525, 16576..16890, 16988..17149, 17335..17829, 17885..18358, 18405..18521, 18965..19325, 19373..19785, 20916..20978, 22571..22696)) |
| Map position | 0.63 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:GCAGATGGAGATGTTTCTGG,IntRev:CAAAATTTCGCTTCCACGGTA,ExtFwd:TGTGCATGTGATATAATTCTTGAT,ExtRev:AATAAAAAATCTTTCAGTTCGTCC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Levitte S, Salesky R, King B, Coe Smith S, Depper M, Cole M, Hermann GJ.
A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function.
FEBS J 2010 277(6) 1420-39
[ PubMed ID = 20148972 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14
[ PubMed ID = 18245353 ]
[ RRC reference ]
|
Sundaram P, Echalier B, Han W, Hull D, Timmons L.
ATP-binding cassette transporters are required for efficient RNA interference in Caenorhabditis elegans.
Mol Biol Cell 2006 17(8) 3678-88
[ PubMed ID = 16723499 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.