Mutants (Isolated)

tm333

Allele Nametm333
Sequence NameDH11.3
CGC Namepgp-11
Worm BaseAllele Name tm333
CGC Name pgp-11
Sequence DH11.3
Phenotypehomozygous viable. Dr. Y-K. Paik: dauer formed on daumone plate.
Mutation site17690/17691-18143/18144 (453 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(15249..15357, 15406..15641, 15803..16003, 16052..16525, 16576..16890, 16988..17149, 17335..17829, 17885..18358, 18405..18521, 18965..19325, 19373..19785, 20916..20978, 22571..22696))
Map position0.63
Balancer
Map position of balancer
Sequence of primersIntFwd:GCAGATGGAGATGTTTCTGG,IntRev:CAAAATTTCGCTTCCACGGTA,ExtFwd:TGTGCATGTGATATAATTCTTGAT,ExtRev:AATAAAAAATCTTTCAGTTCGTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sundaram P, Echalier B, Han W, Hull D, Timmons L.
ATP-binding cassette transporters are required for efficient RNA interference in Caenorhabditis elegans.
Mol. Biol. Cell 2006 17(8) 3678-88 
[ PubMed ID = 16723499 ] [ RRC reference ]

Levitte S, Salesky R, King B, Coe Smith S, Depper M, Cole M, Hermann GJ.
A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function.
FEBS J. 2010 277(6) 1420-39 
[ PubMed ID = 20148972 ] [ RRC reference ]

Sundaram P, Han W, Cohen N, Echalier B, Albin J, Timmons L.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Genetics 2008 178(2) 801-14 
[ PubMed ID = 18245353 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]