分離済み変異体

tm3328

Allele Nametm3328
BalanceCompleted
OutCrossNot Accepted
Sequence NameR06C7.5b
Gene NameR06C7.5
Worm BaseAllele Name tm3328 (x1)
Gene Name R06C7.5
Sequence R06C7.5b
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. H. Sawa: Pvul, Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15617/15618-16409/16410 (792 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(15119..15158, 15259..16331))
Map position1.86
BalancerhT2
Map position of balancer
Sequence of primersIntRev:TGTGCTATCATTGGTGACTC,ExtFwd:GACACCTTCTTCCGTCAGCA,IntFwd:TGCCTTTTCCAAACCAAGGA,ExtRev:GATGGTGTGAAGCGCACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Marsac R, Pinson B, Saint-Marc C, Olmedo M, Artal-Sanz M, Daignan-Fornier B, Gomes JE.
Purine Homeostasis Is Necessary for Developmental Timing, Germline Maintenance and Muscle Integrity in Caenorhabditis elegans.
Genetics 2019 211(4) 1297-1313 
[ PubMed ID = 30700528 ] [ RRC reference ]

Rodríguez-Palero MJ, López-Díaz A, Marsac R, Gomes JE, Olmedo M, Artal-Sanz M.
An automated method for the analysis of food intake behaviour in Caenorhabditis elegans.
Sci Rep 2018 8(1) 3633 
[ PubMed ID = 29483540 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]