| Allele Name | tm3328 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | R06C7.5b |
| Gene Name | R06C7.5 |
| Worm Base | Allele Name |
tm3328
(x1) |
| Gene Name |
R06C7.5
|
| Sequence |
R06C7.5b
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. H. Sawa: Pvul, Ste. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 15617/15618-16409/16410 (792 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(15119..15158, 15259..16331)) |
| Map position | 1.86 |
| Balancer | hT2 |
| Map position of balancer | |
| Sequence of primers | IntRev:TGTGCTATCATTGGTGACTC,ExtFwd:GACACCTTCTTCCGTCAGCA,IntFwd:TGCCTTTTCCAAACCAAGGA,ExtRev:GATGGTGTGAAGCGCACAGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Marsac R, Pinson B, Saint-Marc C, Olmedo M, Artal-Sanz M, Daignan-Fornier B, Gomes JE. Purine Homeostasis Is Necessary for Developmental Timing, Germline Maintenance and Muscle Integrity in Caenorhabditis elegans. Genetics 2019 211(4) 1297-1313
[ PubMed ID = 30700528 ]
[ RRC reference ]
|
Rodríguez-Palero MJ, López-Díaz A, Marsac R, Gomes JE, Olmedo M, Artal-Sanz M. An automated method for the analysis of food intake behaviour in Caenorhabditis elegans. Sci Rep 2018 8(1) 3633
[ PubMed ID = 29483540 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
|