Home > Mutants (Isolated) > tm3328

Mutants (Isolated)

Allele Name		tm3328
Allele Type		Balanced
Sequence Name		R06C7.5b
Gene Name		R06C7.5
Worm Base	Allele Name	tm3328
	Gene Name	R06C7.5
	Sequence	R06C7.5b
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. H. Sawa: Pvul, Ste.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		15617/15618-16409/16410 (792 bp deletion)
Chromosome		I
Putative gene structure		complement(join(15119..15158, 15259..16331))
Map position		1.86
Balancer		hT2
Map position of balancer
Sequence of primers		IntRev:TGTGCTATCATTGGTGACTC,ExtFwd:GACACCTTCTTCCGTCAGCA,IntFwd:TGCCTTTTCCAAACCAAGGA,ExtRev:GATGGTGTGAAGCGCACAGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Marsac R, Pinson B, Saint-Marc C, Olmedo M, Artal-Sanz M, Daignan-Fornier B, Gomes JE. Purine Homeostasis Is Necessary for Developmental Timing, Germline Maintenance and Muscle Integrity in Caenorhabditis elegans. Genetics 2019 211(4) 1297-1313  [ PubMed ID = 30700528 ] [ RRC reference ] Rodríguez-Palero MJ, López-Díaz A, Marsac R, Gomes JE, Olmedo M, Artal-Sanz M. An automated method for the analysis of food intake behaviour in Caenorhabditis elegans. Sci Rep 2018 8(1) 3633  [ PubMed ID = 29483540 ] [ RRC reference ] C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25  [ PubMed ID = 23173093 ] [ RRC reference ]