Mutants (Isolated)

tm3328

Allele Nametm3328
Sequence NameR06C7.5b
CGC NameR06C7.5
Worm BaseAllele Name tm3328
CGC Name R06C7.5
Sequence R06C7.5b
Phenotypelethal or sterile. Dr. H. Sawa: Pvul, Ste.
Mutation site15617/15618-16409/16410 (792 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(15119..15158, 15259..16331))
Map position1.86
BalancerhT2
Map position of balancer
Sequence of primersIntRev:TGTGCTATCATTGGTGACTC,ExtFwd:GACACCTTCTTCCGTCAGCA,IntFwd:TGCCTTTTCCAAACCAAGGA,ExtRev:GATGGTGTGAAGCGCACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rodríguez-Palero MJ, López-Díaz A, Marsac R, Gomes JE, Olmedo M, Artal-Sanz M.
An automated method for the analysis of food intake behaviour in Caenorhabditis elegans.
Sci Rep 2018 8(1) 3633 
[ PubMed ID = 29483540 ] [ RRC reference ]

Marsac R, Pinson B, Saint-Marc C, Olmedo M, Artal-Sanz M, Daignan-Fornier B, Gomes JE.
Purine Homeostasis Is Necessary for Developmental Timing, Germline Maintenance and Muscle Integrity in Caenorhabditis elegans.
Genetics 2019 211(4) 1297-1313 
[ PubMed ID = 30700528 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]