分離済み変異体

tm331

Allele Name

tm331

Allele Type

通常株

Sequence Name

VZK822L.1

Gene Name

fat-6

Worm Base

Allele Name

tm331

Gene Name

fat-6

Sequence

VZK822L.1

Phenotype

homozygous viable. Dr. H. Arai: WT (Brood size, embryonic lethality, larval lehtality, growth rate), Dr. G. Hermann: wild-type gut granules. Dr. K. Sakamoto: J. Biochem 144, 149 (2008). Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006), Genetics 176, 865 (2007).

Mutation site

6436/6437-AATACCGCAATAGGGTTCACTTAAAAACGAATGTTGTAGAATGAAAAAAGAAATAGAAAAGAAGATAAGTGATGTTGAGCATAAAACATAAGATGTGTTGAAAAAGAAAGAAAAACGGAAAATTTGATCAAATTTGAAACGTATCTTTTCCTCTTCTCCCTTTCTTCTTACTTCCGTTCTTCTCTTACTTTCAATCCAATCATGCTCCTTGTCTTCTCATAATTTTATTGCTTTTTGTCTCCTCTTTTCTCGCCTTCTGCAACACAAAGTGCAAACCTAAATTCCATTTAGTTTTCTTACACAAAATGATTGAAAAGTAAATGTTTTATGATGAAAAGTATGAGCCATCATTCATCTGATCATCCATCTCTTTTGTTTAAATATCAATTTTTTAGATTGTGAAGACATGTGAGCAACTTGAAACTGAT-7668/7669 (1232 bp deletion + 428 bp insertion)

Chromosome

Putative gene structure

complement(join(5893..6172,6281..6442,6498..6834, 7133..7253,7623..7742)

Map position

5.39

Balancer

Map position of balancer

Sequence of primers

ExtFwd:ACTCTTGGCACAAAACGGCG,IntFwd:GTTCCCAGTTTTTGACGTGT,IntRev:AAAGGGCCTTGCGTAGTGTA,ExtRev:GATATCAGACGACGGGCAGG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Yamamoto KK, Wan M, Penkar RS, Savage-Dunn C.
BMP-Dependent Mobilization of Fatty Acid Metabolism Promotes Caenorhabditis elegans Survival on a Bacterial Pathogen.
bioRxiv 2025
[ PubMed ID = 40161651 ] [ RRC reference ]

Battista B, Hernandez-Cravero B, Colaiácovo MP, Cochella L, Binolfi A, de Mendoza D.
An inducible and reversible system to regulate unsaturated fatty acid biosynthesis in C. elegans.
G3 (Bethesda) 2025 15(4)
[ PubMed ID = 40097139 ] [ RRC reference ]

An L, Geng B, An L, Wang Y, Zhang Z, Fu X, Chen J, Ma J.
Low molecular weight protein tyrosine phosphatase: A driver of lipid metabolic remodeling in Caenorhabditis elegans.
Int J Biol Macromol 2025 306(Pt 1) 141332
[ PubMed ID = 39988157 ] [ RRC reference ]

Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13
[ PubMed ID = 39951337 ] [ RRC reference ]

Vora M, Dietz J, Wing Z, George K, Kelly Liu J, Rongo C, Savage-Dunn C.
Genome-wide analysis of Smad and Schnurri transcription factors in C. elegans demonstrates widespread interaction and a function in collagen secretion.
Elife 2025 13
[ PubMed ID = 39887187 ] [ RRC reference ]

Ruan M, Xu F, Li N, Yu J, Teng F, Tang J, Huang C, Zhu H.
Free long-chain fatty acids trigger early postembryonic development in starved Caenorhabditis elegans by suppressing mTORC1.
PLoS Biol 2024 22(10) e3002841
[ PubMed ID = 39436954 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ] [ RRC reference ]

Vora M, Dietz J, Wing Z, George K, Liu J, Rongo C, Savage-Dunn C.
Genome-wide analysis of Smad and Schnurri transcription factors in C. elegans demonstrates widespread interaction and a function in collagen secretion.
bioRxiv 2025
[ PubMed ID = 38895257 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ] [ RRC reference ]

Shi H, Zhao J, Li Y, Li J, Li Y, Zhang J, Qiu Z, Wu C, Qin M, Liu C, Zeng Z, Zhang C, Gao L.
Ginsenosides Rg1 regulate lipid metabolism and temperature adaptation in Caenorhabditis elegans.
J Ginseng Res 2023 47(4) 524-533
[ PubMed ID = 37397410 ] [ RRC reference ]

Weng JW, Park H, Valotteau C, Chen RT, Essmann CL, Pujol N, Sternberg PW, Chen CH.
Body stiffness is a mechanical property that facilitates contact-mediated mate recognition in Caenorhabditis elegans.
Curr Biol 2023 33(17) 3585-3596.e5
[ PubMed ID = 37541249 ] [ RRC reference ]

Zhao L, Wu B, Liang S, Min D, Jiang H.
Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans.
Foods 2022 11(24)
[ PubMed ID = 36553826 ] [ RRC reference ]

Qin S, Wang Y, Li L, Liu J, Xiao C, Duan D, Hao W, Qin C, Chen J, Yao L, Zhang R, You J, Zheng JS, Shen E, Wu L.
Early-life vitamin B12 orchestrates lipid peroxidation to ensure reproductive success via SBP-1/SREBP1 in Caenorhabditis elegans.
Cell Rep 2022 40(12) 111381
[ PubMed ID = 36130518 ] [ RRC reference ]

Mudd N, Liceaga AM.
Caenorhabditis elegans as an in vivo model for food bioactives: A review.
Curr Res Food Sci 2022 5 845-856
[ PubMed ID = 35619588 ] [ RRC reference ]

Goncalves J, Wan Y, Garcia LR.
Stearoyl-CoA desaturases sustain cholinergic excitation and copulatory robustness in metabolically aging C. elegansmales.
iScience 2022 25(4) 104082
[ PubMed ID = 35372802 ] [ RRC reference ]

Casorla-Perez LA, Guennoun R, Cubillas C, Peng B, Kornfeld K, Wang D.
Orsay Virus Infection of Caenorhabditis elegans Is Modulated by Zinc and Dependent on Lipids.
J Virol 2022 96(22) e0121122
[ PubMed ID = 36342299 ] [ RRC reference ]

Yue Y, Hao G, Cho J, Park Y.
Curcumin reduced fat accumulation in Caenorhabditis elegans.
Curr Res Food Sci 2021 4 551-556
[ PubMed ID = 34458861 ] [ RRC reference ]

Xie K, Liu Y, Li X, Zhang H, Zhang S, Mak HY, Liu P.
Dietary S. maltophilia induces supersized lipid droplets by enhancing lipogenesis and ER-LD contacts in C. elegans.
Gut Microbes 2022 14(1) 2013762
[ PubMed ID = 35112996 ] [ RRC reference ]

Wan QL, Meng X, Wang C, Dai W, Luo Z, Yin Z, Ju Z, Fu X, Yang J, Ye Q, Zhang ZH, Zhou Q.
Histone H3K4me3 modification is a transgenerational epigenetic signal for lipid metabolism in Caenorhabditis elegans.
Nat Commun 2022 13(1) 768
[ PubMed ID = 35140229 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34236316 ] [ RRC reference ]