Mutants (Isolated)

tm331

Allele Nametm331
Sequence NameVZK822L.1
CGC Namefat-6
Worm BaseAllele Name tm331
CGC Name fat-6
Sequence VZK822L.1
Phenotypehomozygous viable. Dr. H. Arai: WT (Brood size, embryonic lethality, larval lehtality, growth rate), Dr. G. Hermann: wild-type gut granules. Dr. K. Sakamoto: J. Biochem 144, 149 (2008). Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006), Genetics 176, 865 (2007).
Mutation site6436/6437-AATACCGCAATAGGGTTCACTTAAAAACGAATGTTGTAGAATGAAAAAAGAAATAGAAAAGAAGATAAGTGATGTTGAGCATAAAACATAAGATGTGTTGAAAAAGAAAGAAAAACGGAAAATTTGATCAAATTTGAAACGTATCTTTTCCTCTTCTCCCTTTCTTCTTACTTCCGTTCTTCTCTTACTTTCAATCCAATCATGCTCCTTGTCTTCTCATAATTTTATTGCTTTTTGTCTCCTCTTTTCTCGCCTTCTGCAACACAAAGTGCAAACCTAAATTCCATTTAGTTTTCTTACACAAAATGATTGAAAAGTAAATGTTTTATGATGAAAAGTATGAGCCATCATTCATCTGATCATCCATCTCTTTTGTTTAAATATCAATTTTTTAGATTGTGAAGACATGTGAGCAACTTGAAACTGAT-7668/7669 (1232 bp deletion + 428 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(5893..6172,6281..6442,6498..6834, 7133..7253,7623..7742)
Map position5.39
Balancer
Map position of balancer
Sequence of primersExtFwd:ACTCTTGGCACAAAACGGCG,IntFwd:GTTCCCAGTTTTTGACGTGT,IntRev:AAAGGGCCTTGCGTAGTGTA,ExtRev:GATATCAGACGACGGGCAGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Imanikia S, Sheng M, Castro C, Griffin JL, Taylor RC.
XBP-1 Remodels Lipid Metabolism to Extend Longevity.
Cell Rep 2019 28(3) 581-589.e4 
[ PubMed ID = 31315038 ] [ RRC reference ]

Ezcurra M, Benedetto A, Sornda T, Gilliat AF, Au C, Zhang Q, van Schelt S, Petrache AL, Wang H, de la Guardia Y, Bar-Nun S, Tyler E, Wakelam MJ, Gems D.
C. elegans Eats Its Own Intestine to Make Yolk Leading to Multiple Senescent Pathologies.
Curr Biol 2018 28(16) 2544-2556.e5 
[ PubMed ID = 30100339 ] [ RRC reference ]

Anderson SM, Cheesman HK, Peterson ND, Salisbury JE, Soukas AA, Pukkila-Worley R.
The fatty acid oleate is required for innate immune activation and pathogen defense in Caenorhabditis elegans.
PLoS Pathog 2019 15(6) e1007893 
[ PubMed ID = 31206555 ] [ RRC reference ]

Liu J, Peng Y, Yue Y, Shen P, Park Y.
Epigallocatechin-3-Gallate Reduces Fat Accumulation in Caenorhabditis elegans.
Prev Nutr Food Sci 2018 23(3) 214-219 
[ PubMed ID = 30386749 ] [ RRC reference ]

Hyun M, Davis K, Lee I, Kim J, Dumur C, You YJ.
Fat Metabolism Regulates Satiety Behavior in C. elegans.
Sci Rep 2016 6 24841 
[ PubMed ID = 27097601 ] [ RRC reference ]

Clark JF, Meade M, Ranepura G, Hall DH, Savage-Dunn C.
Caenorhabditis elegans DBL-1/BMP Regulates Lipid Accumulation via Interaction with Insulin Signaling.
G3 (Bethesda) 2018 8(1) 343-351 
[ PubMed ID = 29162682 ] [ RRC reference ]

Lee D, An SWA, Jung Y, Yamaoka Y, Ryu Y, Goh GYS, Beigi A, Yang JS, Jung GY, Ma DK, Ha CM, Taubert S, Lee Y, Lee SV.
MDT-15/MED15 permits longevity at low temperature via enhancing lipidostasis and proteostasis.
PLoS Biol 2019 17(8) e3000415 
[ PubMed ID = 31408455 ] [ RRC reference ]

He B, Zhang J, Wang Y, Li Y, Zou X, Liang B.
Identification of cytochrome b5 CYTB-5.1 and CYTB-5.2 in C. elegans; evidence for differential regulation of SCD.
Biochim Biophys Acta Mol Cell Biol Lipids 2018 1863(3) 235-246 
[ PubMed ID = 29237573 ] [ RRC reference ]

Tserevelakis GJ, Megalou EV, Filippidis G, Petanidou B, Fotakis C, Tavernarakis N.
Label-free imaging of lipid depositions in C. elegans using third-harmonic generation microscopy.
PLoS One 2014 9(1) e84431 
[ PubMed ID = 24392137 ] [ RRC reference ]

Dancy BC, Chen SW, Drechsler R, Gafken PR, Olsen CP.
13C- and 15N-Labeling Strategies Combined with Mass Spectrometry Comprehensively Quantify Phospholipid Dynamics in C. elegans.
PLoS One 2015 10(11) e0141850 
[ PubMed ID = 26528916 ] [ RRC reference ]

Savory FR, Sait SM, Hope IA.
DAF-16 and Δ9 desaturase genes promote cold tolerance in long-lived Caenorhabditis elegans age-1 mutants.
PLoS One 2011 6(9) e24550 
[ PubMed ID = 21931751 ] [ RRC reference ]

Vásquez V, Krieg M, Lockhead D, Goodman MB.
Phospholipids that contain polyunsaturated fatty acids enhance neuronal cell mechanics and touch sensation.
Cell Rep 2014 6(1) 70-80 
[ PubMed ID = 24388754 ] [ RRC reference ]

Shi X, Li J, Zou X, Greggain J, Rødkær SV, Færgeman NJ, Liang B, Watts JL.
Regulation of lipid droplet size and phospholipid composition by stearoyl-CoA desaturase.
J Lipid Res 2013 54(9) 2504-14 
[ PubMed ID = 23787165 ] [ RRC reference ]

Chen D, Xu W, Wang Y, Ye Y, Wang Y, Yu M, Gao J, Wei J, Dong Y, Zhang H, Fu X, Ma K, Wang H, Yang Z, Zhou J, Cheng W, Wang S, Chen J, Grant BD, Myers CL, Shi A, Xia T.
Revealing Functional Crosstalk between Distinct Bioprocesses through Reciprocal Functional Tests of Genetically Interacting Genes.
Cell Rep 2019 29(9) 2646-2658.e5 
[ PubMed ID = 31775035 ] [ RRC reference ]

Castro C, Sar F, Shaw WR, Mishima M, Miska EA, Griffin JL.
A metabolomic strategy defines the regulation of lipid content and global metabolism by Δ9 desaturases in Caenorhabditis elegans.
BMC Genomics 2012 13 36 
[ PubMed ID = 22264337 ] [ RRC reference ]

Wang P, Liu B, Zhang D, Belew MY, Tissenbaum HA, Cheng JX.
Imaging lipid metabolism in live Caenorhabditis elegans using fingerprint vibrations.
Angew Chem Int Ed Engl 2014 53(44) 11787-92 
[ PubMed ID = 25195517 ] [ RRC reference ]

Liang B, Ferguson K, Kadyk L, Watts JL.
The role of nuclear receptor NHR-64 in fat storage regulation in Caenorhabditis elegans.
PLoS One 2010 5(3) e9869 
[ PubMed ID = 20360843 ] [ RRC reference ]

Le TT, Duren HM, Slipchenko MN, Hu CD, Cheng JX.
Label-free quantitative analysis of lipid metabolism in living Caenorhabditis elegans.
J Lipid Res 2010 51(3) 672-7 
[ PubMed ID = 19776402 ] [ RRC reference ]

Goudeau J, Bellemin S, Toselli-Mollereau E, Shamalnasab M, Chen Y, Aguilaniu H.
Fatty acid desaturation links germ cell loss to longevity through NHR-80/HNF4 in C. elegans.
PLoS Biol 2011 9(3) e1000599 
[ PubMed ID = 21423649 ] [ RRC reference ]

Goh GY, Martelli KL, Parhar KS, Kwong AW, Wong MA, Mah A, Hou NS, Taubert S.
The conserved Mediator subunit MDT-15 is required for oxidative stress responses in Caenorhabditis elegans.
Aging Cell 2014 13(1) 70-9 
[ PubMed ID = 23957350 ] [ RRC reference ]