分離済み変異体

tm331

Allele Nametm331
Allele Type通常株
Sequence NameVZK822L.1
Gene Namefat-6
Worm BaseAllele Name tm331
Gene Name fat-6
Sequence VZK822L.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Arai: WT (Brood size, embryonic lethality, larval lehtality, growth rate), Dr. G. Hermann: wild-type gut granules. Dr. K. Sakamoto: J. Biochem 144, 149 (2008). Dr. J. Watts & Dr. J. Browse: PLoS Genetics 2, e108 (2006), Genetics 176, 865 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 6436/6437-AATACCGCAATAGGGTTCACTTAAAAACGAATGTTGTAGAATGAAAAAAGAAATAGAAAAGAAGATAAGTGATGTTGAGCATAAAACATAAGATGTGTTGAAAAAGAAAGAAAAACGGAAAATTTGATCAAATTTGAAACGTATCTTTTCCTCTTCTCCCTTTCTTCTTACTTCCGTTCTTCTCTTACTTTCAATCCAATCATGCTCCTTGTCTTCTCATAATTTTATTGCTTTTTGTCTCCTCTTTTCTCGCCTTCTGCAACACAAAGTGCAAACCTAAATTCCATTTAGTTTTCTTACACAAAATGATTGAAAAGTAAATGTTTTATGATGAAAAGTATGAGCCATCATTCATCTGATCATCCATCTCTTTTGTTTAAATATCAATTTTTTAGATTGTGAAGACATGTGAGCAACTTGAAACTGAT-7668/7669 (1232 bp deletion + 428 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(5893..6172,6281..6442,6498..6834, 7133..7253,7623..7742)
Map position5.39
Balancer
Map position of balancer
Sequence of primersExtFwd:ACTCTTGGCACAAAACGGCG,IntFwd:GTTCCCAGTTTTTGACGTGT,IntRev:AAAGGGCCTTGCGTAGTGTA,ExtRev:GATATCAGACGACGGGCAGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shi H, Zhao J, Li Y, Li J, Li Y, Zhang J, Qiu Z, Wu C, Qin M, Liu C, Zeng Z, Zhang C, Gao L.
Ginsenosides Rg1 regulate lipid metabolism and temperature adaptation in Caenorhabditis elegans.
J Ginseng Res 2023 47(4) 524-533 
[ PubMed ID = 37397410 ] [ RRC reference ]

Weng JW, Park H, Valotteau C, Chen RT, Essmann CL, Pujol N, Sternberg PW, Chen CH.
Body stiffness is a mechanical property that facilitates contact-mediated mate recognition in Caenorhabditis elegans.
Curr Biol 2023 33(17) 3585-3596.e5 
[ PubMed ID = 37541249 ] [ RRC reference ]

Zhao L, Wu B, Liang S, Min D, Jiang H.
Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans.
Foods 2022 11(24)  
[ PubMed ID = 36553826 ] [ RRC reference ]

Qin S, Wang Y, Li L, Liu J, Xiao C, Duan D, Hao W, Qin C, Chen J, Yao L, Zhang R, You J, Zheng JS, Shen E, Wu L.
Early-life vitamin B12 orchestrates lipid peroxidation to ensure reproductive success via SBP-1/SREBP1 in Caenorhabditis elegans.
Cell Rep 2022 40(12) 111381 
[ PubMed ID = 36130518 ] [ RRC reference ]

Mudd N, Liceaga AM.
Caenorhabditis elegans as an in vivo model for food bioactives: A review.
Curr Res Food Sci 2022 5 845-856 
[ PubMed ID = 35619588 ] [ RRC reference ]

Goncalves J, Wan Y, Garcia LR.
Stearoyl-CoA desaturases sustain cholinergic excitation and copulatory robustness in metabolically aging C. elegansmales.
iScience 2022 25(4) 104082 
[ PubMed ID = 35372802 ] [ RRC reference ]

Casorla-Perez LA, Guennoun R, Cubillas C, Peng B, Kornfeld K, Wang D.
Orsay Virus Infection of Caenorhabditis elegans Is Modulated by Zinc and Dependent on Lipids.
J Virol 2022 96(22) e0121122 
[ PubMed ID = 36342299 ] [ RRC reference ]

Yue Y, Hao G, Cho J, Park Y.
Curcumin reduced fat accumulation in Caenorhabditis elegans.
Curr Res Food Sci 2021 4 551-556 
[ PubMed ID = 34458861 ] [ RRC reference ]

Xie K, Liu Y, Li X, Zhang H, Zhang S, Mak HY, Liu P.
Dietary S. maltophilia induces supersized lipid droplets by enhancing lipogenesis and ER-LD contacts in C. elegans.
Gut Microbes 2022 14(1) 2013762 
[ PubMed ID = 35112996 ] [ RRC reference ]

Wan QL, Meng X, Wang C, Dai W, Luo Z, Yin Z, Ju Z, Fu X, Yang J, Ye Q, Zhang ZH, Zhou Q.
Histone H3K4me3 modification is a transgenerational epigenetic signal for lipid metabolism in Caenorhabditis elegans.
Nat Commun 2022 13(1) 768 
[ PubMed ID = 35140229 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10  
[ PubMed ID = 34236316 ] [ RRC reference ]

Choi LS, Shi C, Ashraf J, Sohrabi S, Murphy CT.
Oleic Acid Protects Caenorhabditis Mothers From Mating-Induced Death and the Cost of Reproduction.
Front Cell Dev Biol 2021 9 690373 
[ PubMed ID = 34179018 ] [ RRC reference ]

Chauve L, Hodge F, Murdoch S, Masoudzadeh F, Mann HJ, Lopez-Clavijo AF, Okkenhaug H, West G, Sousa BC, Segonds-Pichon A, Li C, Wingett SW, Kienberger H, Kleigrewe K, de Bono M, Wakelam MJO, Casanueva O.
Neuronal HSF-1 coordinates the propagation of fat desaturation across tissues to enable adaptation to high temperatures in C. elegans.
PLoS Biol 2021 19(11) e3001431 
[ PubMed ID = 34723964 ] [ RRC reference ]

Chamoli M, Goyala A, Tabrez SS, Siddiqui AA, Singh A, Antebi A, Lithgow GJ, Watts JL, Mukhopadhyay A.
Polyunsaturated fatty acids and p38-MAPK link metabolic reprogramming to cytoprotective gene expression during dietary restriction.
Nat Commun 2020 11(1) 4865 
[ PubMed ID = 32978396 ] [ RRC reference ]

Lee D, An SWA, Jung Y, Yamaoka Y, Ryu Y, Goh GYS, Beigi A, Yang JS, Jung GY, Ma DK, Ha CM, Taubert S, Lee Y, Lee SV.
MDT-15/MED15 permits longevity at low temperature via enhancing lipidostasis and proteostasis.
PLoS Biol 2019 17(8) e3000415 
[ PubMed ID = 31408455 ] [ RRC reference ]

Imanikia S, Sheng M, Castro C, Griffin JL, Taylor RC.
XBP-1 Remodels Lipid Metabolism to Extend Longevity.
Cell Rep 2019 28(3) 581-589.e4 
[ PubMed ID = 31315038 ] [ RRC reference ]

Chen D, Xu W, Wang Y, Ye Y, Wang Y, Yu M, Gao J, Wei J, Dong Y, Zhang H, Fu X, Ma K, Wang H, Yang Z, Zhou J, Cheng W, Wang S, Chen J, Grant BD, Myers CL, Shi A, Xia T.
Revealing Functional Crosstalk between Distinct Bioprocesses through Reciprocal Functional Tests of Genetically Interacting Genes.
Cell Rep 2019 29(9) 2646-2658.e5 
[ PubMed ID = 31775035 ] [ RRC reference ]

Anderson SM, Cheesman HK, Peterson ND, Salisbury JE, Soukas AA, Pukkila-Worley R.
The fatty acid oleate is required for innate immune activation and pathogen defense in Caenorhabditis elegans.
PLoS Pathog 2019 15(6) e1007893 
[ PubMed ID = 31206555 ] [ RRC reference ]

Liu J, Peng Y, Yue Y, Shen P, Park Y.
Epigallocatechin-3-Gallate Reduces Fat Accumulation in Caenorhabditis elegans.
Prev Nutr Food Sci 2018 23(3) 214-219 
[ PubMed ID = 30386749 ] [ RRC reference ]

Ezcurra M, Benedetto A, Sornda T, Gilliat AF, Au C, Zhang Q, van Schelt S, Petrache AL, Wang H, de la Guardia Y, Bar-Nun S, Tyler E, Wakelam MJ, Gems D.
C. elegans Eats Its Own Intestine to Make Yolk Leading to Multiple Senescent Pathologies.
Curr Biol 2018 28(16) 2544-2556.e5 
[ PubMed ID = 30100339 ] [ RRC reference ]