Mutants (Isolated)

tm3298

Allele Nametm3298
BalanceCompleted
OutCrossNot Accepted
Sequence NameY71H2AM.7
Gene Namecosa-1
Worm BaseAllele Name tm3298 (x1)
Gene Name cosa-1
Sequence Y71H2AM.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 35092/35093-35427/35428 (335 bp deletion)
ChromosomeIII
Putative gene structurejoin(34915..35260, 35435..35567, 36344..36515, 37225..37334, 38048..38254, 39905..40097, 40170..40205)
Map position-11.4
Balancer,qC1[nIs281]
Map position of balancer
Sequence of primersIntRev:CACAATGCTGCGTAAATCGA,ExtRev:GGGAGTACACAATGCTGCGT,IntFwd:GCACCGAACCAGGTGTAGTA,ExtFwd:GTATTGGTCTCGCACCGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gold AL, Hurlock ME, Guevara AM, Isenberg LYZ, Kim Y.
Identification of the Polo-like kinase substrate required for homologous synapsis.
J Cell Biol 2025 224(3)  
[ PubMed ID = 39680026 ] [ RRC reference ]

Odiba AS, Liao G, Yuan H, Fang W, Wang B.
Dual tagging of GFP and Degron on endogenous COSA-1 in Caenorhabditis elegans as a crossover investigation tool.
MicroPubl Biol 2024 2024  
[ PubMed ID = 38304162 ] [ RRC reference ]

Cahoon CK, Richter CM, Dayton AE, Libuda DE.
Sexual dimorphic regulation of recombination by the synaptonemal complex in C. elegans.
Elife 2023 12  
[ PubMed ID = 37796106 ] [ RRC reference ]

Haversat J, Woglar A, Klatt K, Akerib CC, Roberts V, Chen SY, Arur S, Villeneuve AM, Kim Y.
Robust designation of meiotic crossover sites by CDK-2 through phosphorylation of the MutSγ complex.
Proc Natl Acad Sci U S A 2022 119(21) e2117865119 
[ PubMed ID = 35576467 ] [ RRC reference ]

Das D, Trivedi S, Blazícková J, Arur S, Silva N.
Phosphorylation of HORMA-domain protein HTP-3 at Serine 285 is dispensable for crossover formation.
G3 (Bethesda) 2022 12(5)  
[ PubMed ID = 35389463 ] [ RRC reference ]

Velkova M, Silva N, Dello Stritto MR, Schleiffer A, Barraud P, Hartl M, Jantsch V.
Caenorhabditis elegans RMI2 functional homolog-2 (RMIF-2) and RMI1 (RMH-1) have both overlapping and distinct meiotic functions within the BTR complex.
PLoS Genet 2021 17(7) e1009663 
[ PubMed ID = 34252074 ] [ RRC reference ]

Brandt JN, Hussey KA, Kim Y.
Spatial and temporal control of targeting Polo-like kinase during meiotic prophase.
J Cell Biol 2020 219(11)  
[ PubMed ID = 32997737 ] [ RRC reference ]

Cahoon CK, Helm JM, Libuda DE.
Synaptonemal Complex Central Region Proteins Promote Localization of Pro-crossover Factors to Recombination Events During Caenorhabditis elegans Meiosis.
Genetics 2019 213(2) 395-409 
[ PubMed ID = 31431470 ] [ RRC reference ]

Janisiw E, Dello Stritto MR, Jantsch V, Silva N.
BRCA1-BARD1 associate with the synaptonemal complex and pro-crossover factors and influence RAD-51 dynamics during Caenorhabditis elegans meiosis.
PLoS Genet 2018 14(11) e1007653 
[ PubMed ID = 30383754 ] [ RRC reference ]

Nguyen H, Labella S, Silva N, Jantsch V, Zetka M.
C. elegans ZHP-4 is required at multiple distinct steps in the formation of crossovers and their transition to segregation competent chiasmata.
PLoS Genet 2018 14(10) e1007776 
[ PubMed ID = 30379819 ] [ RRC reference ]

Crawley O, Barroso C, Testori S, Ferrandiz N, Silva N, Castellano-Pozo M, Jaso-Tamame AL, Martinez-Perez E.
Cohesin-interacting protein WAPL-1 regulates meiotic chromosome structure and cohesion by antagonizing specific cohesin complexes.
Elife 2016 5 e10851 
[ PubMed ID = 26841696 ] [ RRC reference ]

Schvarzstein M, Pattabiraman D, Libuda DE, Ramadugu A, Tam A, Martinez-Perez E, Roelens B, Zawadzki KA, Yokoo R, Rosu S, Severson AF, Meyer BJ, Nabeshima K, Villeneuve AM.
DNA helicase HIM-6/BLM both promotes MutSγ-dependent crossovers and antagonizes MutSγ-independent interhomolog associations during caenorhabditis elegans meiosis.
Genetics 2014 198(1) 193-207 
[ PubMed ID = 25053665 ] [ RRC reference ]

Silva N, Adamo A, Santonicola P, Martinez-Perez E, La Volpe A.
Pro-crossover factors regulate damage-dependent apoptosis in the Caenorhabditis elegans germ line.
Cell Death Differ 2013 20(9) 1209-18 
[ PubMed ID = 23832114 ] [ RRC reference ]

Rosu S, Zawadzki KA, Stamper EL, Libuda DE, Reese AL, Dernburg AF, Villeneuve AM.
The C. elegans DSB-2 protein reveals a regulatory network that controls competence for meiotic DSB formation and promotes crossover assurance.
PLoS Genet 2013 9(8) e1003674 
[ PubMed ID = 23950729 ] [ RRC reference ]

Yokoo R, Zawadzki KA, Nabeshima K, Drake M, Arur S, Villeneuve AM.
COSA-1 reveals robust homeostasis and separable licensing and reinforcement steps governing meiotic crossovers.
Cell 2012 149(1) 75-87 
[ PubMed ID = 22464324 ] [ RRC reference ]