Mutants (Isolated)

tm3298

Allele Nametm3298
Allele TypeNormal
Sequence NameY71H2AM.7
Gene Namecosa-1
Worm BaseAllele Name tm3298
Gene Name cosa-1
Sequence Y71H2AM.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 35092/35093-35427/35428 (335 bp deletion)
ChromosomeIII
Putative gene structurejoin(34915..35260, 35435..35567, 36344..36515, 37225..37334, 38048..38254, 39905..40097, 40170..40205)
Map position-11.4
Balancer
Map position of balancer
Sequence of primersIntRev:CACAATGCTGCGTAAATCGA,ExtRev:GGGAGTACACAATGCTGCGT,IntFwd:GCACCGAACCAGGTGTAGTA,ExtFwd:GTATTGGTCTCGCACCGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Haversat J, Woglar A, Klatt K, Akerib CC, Roberts V, Chen SY, Arur S, Villeneuve AM, Kim Y.
Robust designation of meiotic crossover sites by CDK-2 through phosphorylation of the MutSγ complex.
Proc Natl Acad Sci U S A 2022 119(21) e2117865119 
[ PubMed ID = 35576467 ] [ RRC reference ]

Das D, Trivedi S, Blazícková J, Arur S, Silva N.
Phosphorylation of HORMA-domain protein HTP-3 at Serine 285 is dispensable for crossover formation.
G3 (Bethesda) 2022 12(5)  
[ PubMed ID = 35389463 ] [ RRC reference ]

Velkova M, Silva N, Dello Stritto MR, Schleiffer A, Barraud P, Hartl M, Jantsch V.
Caenorhabditis elegans RMI2 functional homolog-2 (RMIF-2) and RMI1 (RMH-1) have both overlapping and distinct meiotic functions within the BTR complex.
PLoS Genet 2021 17(7) e1009663 
[ PubMed ID = 34252074 ] [ RRC reference ]

Brandt JN, Hussey KA, Kim Y.
Spatial and temporal control of targeting Polo-like kinase during meiotic prophase.
J Cell Biol 2020 219(11)  
[ PubMed ID = 32997737 ] [ RRC reference ]

Cahoon CK, Helm JM, Libuda DE.
Synaptonemal Complex Central Region Proteins Promote Localization of Pro-crossover Factors to Recombination Events During Caenorhabditis elegans Meiosis.
Genetics 2019 213(2) 395-409 
[ PubMed ID = 31431470 ] [ RRC reference ]

Nguyen H, Labella S, Silva N, Jantsch V, Zetka M.
C. elegans ZHP-4 is required at multiple distinct steps in the formation of crossovers and their transition to segregation competent chiasmata.
PLoS Genet 2018 14(10) e1007776 
[ PubMed ID = 30379819 ] [ RRC reference ]

Janisiw E, Dello Stritto MR, Jantsch V, Silva N.
BRCA1-BARD1 associate with the synaptonemal complex and pro-crossover factors and influence RAD-51 dynamics during Caenorhabditis elegans meiosis.
PLoS Genet 2018 14(11) e1007653 
[ PubMed ID = 30383754 ] [ RRC reference ]

Crawley O, Barroso C, Testori S, Ferrandiz N, Silva N, Castellano-Pozo M, Jaso-Tamame AL, Martinez-Perez E.
Cohesin-interacting protein WAPL-1 regulates meiotic chromosome structure and cohesion by antagonizing specific cohesin complexes.
Elife 2016 5 e10851 
[ PubMed ID = 26841696 ] [ RRC reference ]

Silva N, Adamo A, Santonicola P, Martinez-Perez E, La Volpe A.
Pro-crossover factors regulate damage-dependent apoptosis in the Caenorhabditis elegans germ line.
Cell Death Differ 2013 20(9) 1209-18 
[ PubMed ID = 23832114 ] [ RRC reference ]

Rosu S, Zawadzki KA, Stamper EL, Libuda DE, Reese AL, Dernburg AF, Villeneuve AM.
The C. elegans DSB-2 protein reveals a regulatory network that controls competence for meiotic DSB formation and promotes crossover assurance.
PLoS Genet 2013 9(8) e1003674 
[ PubMed ID = 23950729 ] [ RRC reference ]

Schvarzstein M, Pattabiraman D, Libuda DE, Ramadugu A, Tam A, Martinez-Perez E, Roelens B, Zawadzki KA, Yokoo R, Rosu S, Severson AF, Meyer BJ, Nabeshima K, Villeneuve AM.
DNA helicase HIM-6/BLM both promotes MutSγ-dependent crossovers and antagonizes MutSγ-independent interhomolog associations during caenorhabditis elegans meiosis.
Genetics 2014 198(1) 193-207 
[ PubMed ID = 25053665 ] [ RRC reference ]

Yokoo R, Zawadzki KA, Nabeshima K, Drake M, Arur S, Villeneuve AM.
COSA-1 reveals robust homeostasis and separable licensing and reinforcement steps governing meiotic crossovers.
Cell 2012 149(1) 75-87 
[ PubMed ID = 22464324 ] [ RRC reference ]