分離済み変異体

tm3294

Allele Nametm3294
BalanceNot Required
OutCrossNot Accepted
Sequence NameK08F4.7
Gene Namegst-4
Worm BaseAllele Name tm3294
Gene Name gst-4
Sequence K08F4.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21702/21703-AG-21909/21910 (207 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structurejoin(21626..21758, 21813..21905, 21950..22077, 22124..22393)
Map position4.55
Balancer
Map position of balancer
Sequence of primersExtRev:TAGATAGTTCGGTGCTTCAG,IntRev:ATCAGCCCAAGTCAATGAGT,ExtFwd:CCAGACGATGACATTACACT,IntFwd:CTCTTGCTGAGCCAATCCGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lei M, Wu J, Tan Y, Shi Y, Yang W, Tu H, Tan W.
β-asarone protects against age-related motor decline via activation of SKN-1/Nrf2 and subsequent induction of GST-4.
Pharmacol Res 2024 209 107450 
[ PubMed ID = 39366648 ] [ RRC reference ]

Tsai Y, Lin YC, Lee YH.
Octopamine-MAPK-SKN-1 signaling suppresses mating-induced oxidative stress in Caenorhabditis elegans gonads to protect fertility.
iScience 2023 26(3) 106162 
[ PubMed ID = 36876134 ] [ RRC reference ]

Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]

Edmonds JW, Prasain JK, Dorand D, Yang Y, Hoang HD, Vibbert J, Kubagawa HM, Miller MA.
Insulin/FOXO signaling regulates ovarian prostaglandins critical for reproduction.
Dev Cell 2010 19(6) 858-71 
[ PubMed ID = 21145501 ] [ RRC reference ]