Mutants (Isolated)

tm3289

Allele Nametm3289
BalanceNot Required
OutCrossNot Accepted
Sequence NameF59F4.4
Gene Nameacl-1
Worm BaseAllele Name tm3289
Gene Name acl-1
Sequence F59F4.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19238/19239-19535/19536 (297 bp deletion)
ChromosomeX
Putative gene structurejoin(19219..19388, 19481..19614, 19985..20160, 20216..20311, 20674..20712, Z81089.1:108..281)
Map position22.96
Balancer
Map position of balancer
Sequence of primersExtFwd:TCTAGGCCATCTCAAGTGTC,IntFwd:GTCGATTTACGAGGAGGCAT,ExtRev:TTCTGGGTAGATCCACACCT,IntRev:CAATCTCGTGGAGCGTGGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ohba Y, Sakuragi T, Kage-Nakadai E, Tomioka NH, Kono N, Imae R, Inoue A, Aoki J, Ishihara N, Inoue T, Mitani S, Arai H.
Mitochondria-type GPAT is required for mitochondrial fusion.
EMBO J 2013 32(9) 1265-79 
[ PubMed ID = 23572076 ] [ RRC reference ]