Mutants (Isolated)

tm3246

Allele Nametm3246
BalanceCompleted
OutCrossNot Accepted
Sequence NameT06E8.1
Gene Nameacl-2
Worm BaseAllele Name tm3246 (x1)
Gene Name acl-2
Sequence T06E8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4188/4189-GACC-4529/4530 (341 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(2119..2259, 2640..2942, 3210..3317, 4313..4435, 4669..4842))
Map position2.23
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersIntFwd:GGGTGGAGTCAACAGACCAC,ExtRev:ACCGGGCGCCGAACTTTACA,IntRev:TTGTACCCGTTTGTGGCTTA,ExtFwd:CCCATCACTCACTCATCATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ohba Y, Sakuragi T, Kage-Nakadai E, Tomioka NH, Kono N, Imae R, Inoue A, Aoki J, Ishihara N, Inoue T, Mitani S, Arai H.
Mitochondria-type GPAT is required for mitochondrial fusion.
EMBO J 2013 32(9) 1265-79 
[ PubMed ID = 23572076 ] [ RRC reference ]