Mutants (Isolated)

tm3229

Allele Nametm3229
Sequence NameK06H7.3
CGC Namevms-1
Worm BaseAllele Name tm3229
CGC Name vms-1
Sequence K06H7.3
Phenotypehomozygous viable. Dr. K. Ashrafi: increased sensitivity to hydrogen peroxide.
Mutation site9229/9230-GAACAAAC-9498/9499 (269 bp deletion + 8 bp insertion)
ChromosomeIII
Putative gene structurejoin(8170..8314, 8364..8475, 8519..8598, 8645..8765, 9158..9271, 9320..9445, 9496..9988, 10191..10364, 10424..10663, 10711..10863, 11005..11103)
Map position-0.38
Balancer
Map position of balancer
Sequence of primersExtFwd:TAATTCTGAACCCTGGACAC,IntFwd:TCCACGTGGGTGAGCGAGAT,ExtRev:CCGGCCATTACGGTCCGTTT,IntRev:CCTTGGCCATTGAACAACCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Heo JM, Livnat-Levanon N, Taylor EB, Jones KT, Dephoure N, Ring J, Xie J, Brodsky JL, Madeo F, Gygi SP, Ashrafi K, Glickman MH, Rutter J.
A stress-responsive system for mitochondrial protein degradation.
Mol Cell 2010 40(3) 465-80 
[ PubMed ID = 21070972 ] [ RRC reference ]