Home > Mutants (Isolated) > tm3222

Mutants (Isolated)

Allele Name		tm3222
Balance		Not Required
OutCross		Not Accepted
Sequence Name		C41D11.8
Gene Name		cps-6
Worm Base	Allele Name	tm3222
	Gene Name	cps-6
	Sequence	C41D11.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		24001/24002-24337/24338 (336 bp deletion)
Chromosome		I
Putative gene structure		complement(join(23679..24030, 24286..24440, 24497..24619, 25129..25305, 25352..25471))
Map position		-1.28
Balancer
Map position of balancer
Sequence of primers		ExtRev:CCAGGTCTGCGAACATCTTA,IntRev:CACGCAGAAGGTGTGGATCG,ExtFwd:CCACCTTCCCCTATTTCGGA,IntFwd:CACAATGCTCTTAGGGTCCA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Wang S, Xue D. Asymmetric partitioning of persistent paternal mitochondria during cell divisions safeguards embryo development and mitochondrial inheritance. Dev Cell 2025    [ PubMed ID = 39904343 ] [ RRC reference ] Zhang H, Zhu Y, Xue D. Moderate embryonic delay of paternal mitochondrial elimination impairs mating and cognition and alters behaviors of adult animals. Sci Adv 2024 10(40) eadp8351  [ PubMed ID = 39365857 ] [ RRC reference ] Wang W, Li J, Tan J, Wang M, Yang J, Zhang ZM, Li C, Basnakian AG, Tang HW, Perrimon N, Zhou Q. Endonuclease G promotes autophagy by suppressing mTOR signaling and activating the DNA damage response. Nat Commun 2021 12(1) 476  [ PubMed ID = 33473107 ] [ RRC reference ] Zhou Q, Li H, Li H, Nakagawa A, Lin JL, Lee ES, Harry BL, Skeen-Gaar RR, Suehiro Y, William D, Mitani S, Yuan HS, Kang BH, Xue D. Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization. Science 2016 353(6297) 394-9  [ PubMed ID = 27338704 ] [ RRC reference ]