Mutants (Isolated)

tm3222

Allele Nametm3222
Sequence NameC41D11.8
CGC Namecps-6
Worm BaseAllele Name tm3222
CGC Name cps-6
Sequence C41D11.8
Phenotypehomozygous viable.
Mutation site24001/24002-24337/24338 (336 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(23679..24030, 24286..24440, 24497..24619, 25129..25305, 25352..25471))
Map position-1.28
Balancer
Map position of balancer
Sequence of primersExtRev:CCAGGTCTGCGAACATCTTA,IntRev:CACGCAGAAGGTGTGGATCG,ExtFwd:CCACCTTCCCCTATTTCGGA,IntFwd:CACAATGCTCTTAGGGTCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zhou Q, Li H, Li H, Nakagawa A, Lin JL, Lee ES, Harry BL, Skeen-Gaar RR, Suehiro Y, William D, Mitani S, Yuan HS, Kang BH, Xue D.
Mitochondrial endonuclease G mediates breakdown of paternal mitochondria upon fertilization.
Science 2016 353(6297) 394-9 
[ PubMed ID = 27338704 ] [ RRC reference ]