Mutants (Isolated)

tm322

Allele Nametm322
Sequence NameB0207.11
CGC NameB0207.11
Worm BaseAllele Name tm322
CGC Name B0207.11
Sequence B0207.11
Phenotypehomozygous viable
Mutation site44495/44496-44907/44908 (412 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(43985..44414, 44463..44537, 44585..44838, 45016..45078))
Map position0.5
Balancer
Map position of balancer
Sequence of primersIntFwd:TCTTCTATTCAAGCCACCAAGAAA,IntRev:CTGATGTTCACTGGTACCTG,ExtFwd:ATCATTGAATCCACTTGTTTACTC,ExtRev:GTTCTTTGCACAGGTATCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McGovern M, Yu L, Kosinski M, Greenstein D, Savage-Dunn C.
A role for sperm in regulation of egg-laying in the nematode C. elegans.
BMC Dev Biol 2007 7 41 
[ PubMed ID = 17472754 ] [ RRC reference ]