Mutants (Isolated)

tm3210

Allele Nametm3210
Sequence NameC06G4.5
CGC Namenpr-17
Worm BaseAllele Name tm3210
CGC Name npr-17
Sequence C06G4.5
Phenotypehomozygous viable.
Mutation site16353/16354-16562/16563 (209 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(14855..15100,15420..15512,15807..15892, 16493..16673, 17208..17359, 17486..17585, 19398..19499))
Map position-0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GAGTCGATATCCACTGTGCA,IntFwd:TGTCAGCATTCCGGGTGCTG,ExtRev:GTGCAGGTTCAAATCCGTAG,IntRev:TTCGGTAAAATCCTGAGTGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mills H, Ortega A, Law W, Hapiak V, Summers P, Clark T, Komuniecki R.
Opiates Modulate Noxious Chemical Nociception through a Complex Monoaminergic/Peptidergic Cascade.
J. Neurosci. 2016 36(20) 5498-508 
[ PubMed ID = 27194330 ] [ RRC reference ]

Cheong MC, Artyukhin AB, You YJ, Avery L.
An opioid-like system regulating feeding behavior in C. elegans.
Elife 2015 4  
[ PubMed ID = 25898004 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J. 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J. Neurosci. 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]