分離済み変異体

tm3210

Allele Nametm3210
Allele Type通常株
Sequence NameC06G4.5
Gene Namenpr-17
Worm BaseAllele Name tm3210
Gene Name npr-17
Sequence C06G4.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16353/16354-16562/16563 (209 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(14855..15100,15420..15512,15807..15892, 16493..16673, 17208..17359, 17486..17585, 19398..19499))
Map position-0.45
Balancer
Map position of balancer
Sequence of primersExtFwd:GAGTCGATATCCACTGTGCA,IntFwd:TGTCAGCATTCCGGGTGCTG,ExtRev:GTGCAGGTTCAAATCCGTAG,IntRev:TTCGGTAAAATCCTGAGTGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Otarigho B, Butts AF, Aballay A.
Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans.
Elife 2024 12  
[ PubMed ID = 38446031 ] [ RRC reference ]

Kim AT, Li S, Kim Y, You YJ, Park Y.
Food preference-based screening method for identification of effectors of substance use disorders using Caenorhabditis elegans.
Life Sci 2024 345 122580 
[ PubMed ID = 38514005 ] [ RRC reference ]

Chai CM, Park H, Sternberg PW.
Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision.
Curr Biol 2022 32(15) 3365-3373.e6 
[ PubMed ID = 35679871 ] [ RRC reference ]

Ide S, Kunitomo H, Iino Y, Ikeda K.
Caenorhabditis Elegans Exhibits Morphine Addiction-like Behavior via the Opioid-like Receptor NPR-17.
Front Pharmacol 2021 12 802701 
[ PubMed ID = 35046825 ] [ RRC reference ]

Ide S, Kunitomo H, Iino Y, Ikeda K.
Caenorhabditis Elegans Exhibits Morphine Addiction-like Behavior via the Opioid-like Receptor NPR-17.
Front Pharmacol 2021 12 802701 
[ PubMed ID = 35046825 ] [ RRC reference ]

Park JY, Cheong MC, Cho JY, Koo HS, Paik YK.
A novel functional cross-interaction between opioid and pheromone signaling may be involved in stress avoidance in Caenorhabditis elegans.
Sci Rep 2020 10(1) 7524 
[ PubMed ID = 32371913 ] [ RRC reference ]

Mills H, Ortega A, Law W, Hapiak V, Summers P, Clark T, Komuniecki R.
Opiates Modulate Noxious Chemical Nociception through a Complex Monoaminergic/Peptidergic Cascade.
J Neurosci 2016 36(20) 5498-508 
[ PubMed ID = 27194330 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J Neurosci 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Cheong MC, Artyukhin AB, You YJ, Avery L.
An opioid-like system regulating feeding behavior in C. elegans.
Elife 2015 4  
[ PubMed ID = 25898004 ] [ RRC reference ]