Allele Name | tm3171 |
Sequence Name | F39B1.1 |
CGC Name | F39B1.1 |
Worm Base | Allele Name |
tm3171
|
CGC Name |
F39B1.1
|
Sequence |
F39B1.1
|
Phenotype | homozygous viable |
Mutation site | 10417/10418-TTTATTTTTATAAC-11090/11091 (673 bp deletion + 18 bp insertion) |
Chromosome | X |
Putative gene structure | complement(join(6892..7089, 7166..7311, 7366..7516, 9378..9513, 9564..9664, 9715..9790, 9998..10242, 10294..10450, 10501..10937, 11183..11768, 11854..12300, 12347..12507, 12558..13006, 13432..13550, 13603..13766, Z69903.1:269..398, Z69903.1:1618..1846, Z69903.1:1891..1999, Z69903.1:2880..3094, Z69903.1:3301..3468, Z69903.1:3599..3804, Z69903.1:4079..4228, Z69903.1:4329..4372)) |
Map position | 22.3 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GCCAGGAATGTCAGAGCAAG,IntFwd:TGTCAGAGCAAGCCATCTAA,ExtRev:ATCAGGATACATCGACGCTA,IntRev:CGACGCTAGAGACGGATGAT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Lu N, Shen Q, Mahoney TR, Neukomm LJ, Wang Y, Zhou Z. Two PI 3-kinases and one PI 3-phosphatase together establish the cyclic waves of phagosomal PtdIns(3)P critical for the degradation of apoptotic cells. PLoS Biol 2012 10(1) e1001245
[ PubMed ID = 22272187 ]
[ RRC reference ]
|
Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C. Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion. J Cell Biol 2016 212(2) 181-98
[ PubMed ID = 26783301 ]
[ RRC reference ]
|
Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z. Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling. Mol Biol Cell 2011 22(3) 354-74
[ PubMed ID = 21148288 ]
[ RRC reference ]
|
|