Mutants (Isolated)

tm3171

Allele Nametm3171
Sequence NameF39B1.1
CGC NameF39B1.1
Worm BaseAllele Name tm3171
CGC Name F39B1.1
Sequence F39B1.1
Phenotypehomozygous viable
Mutation site10417/10418-TTTATTTTTATAAC-11090/11091 (673 bp deletion + 18 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(6892..7089, 7166..7311, 7366..7516, 9378..9513, 9564..9664, 9715..9790, 9998..10242, 10294..10450, 10501..10937, 11183..11768, 11854..12300, 12347..12507, 12558..13006, 13432..13550, 13603..13766, Z69903.1:269..398, Z69903.1:1618..1846, Z69903.1:1891..1999, Z69903.1:2880..3094, Z69903.1:3301..3468, Z69903.1:3599..3804, Z69903.1:4079..4228, Z69903.1:4329..4372))
Map position22.3
Balancer
Map position of balancer
Sequence of primersExtFwd:GCCAGGAATGTCAGAGCAAG,IntFwd:TGTCAGAGCAAGCCATCTAA,ExtRev:ATCAGGATACATCGACGCTA,IntRev:CGACGCTAGAGACGGATGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lu N, Shen Q, Mahoney TR, Neukomm LJ, Wang Y, Zhou Z.
Two PI 3-kinases and one PI 3-phosphatase together establish the cyclic waves of phagosomal PtdIns(3)P critical for the degradation of apoptotic cells.
PLoS Biol 2012 10(1) e1001245 
[ PubMed ID = 22272187 ] [ RRC reference ]

Liu K, Jian Y, Sun X, Yang C, Gao Z, Zhang Z, Liu X, Li Y, Xu J, Jing Y, Mitani S, He S, Yang C.
Negative regulation of phosphatidylinositol 3-phosphate levels in early-to-late endosome conversion.
J Cell Biol 2016 212(2) 181-98 
[ PubMed ID = 26783301 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol Biol Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]