| Allele Name | tm3141 |
| Allele Type | 通常株 |
| Sequence Name | ZK593.4 |
| Gene Name | rbr-2 |
| Worm Base | Allele Name |
tm3141
|
| Gene Name |
rbr-2
|
| Sequence |
ZK593.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 12470/12471-CACTAAAC-12835/12836 (365 bp deletion + 8 bp insertion) |
| Chromosome | IV |
| Putative gene structure | join(10313..10456, 10507..10638, 10898..11334, 11563..11750, 11800..13810, 13974..14161, 14208..14503, 14935..15590, 15636..15934, 16314..16396) |
| Map position | 4.74 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GGCACTCTTGGCTGTATGAC,ExtRev:CGGCTCTCTGACATCGGGTT,IntFwd:GAGAGACGTTGCCCGCGAAT,ExtFwd:CCTTTACATTTCGTCCCCGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Abay-Nørgaard S, Attianese B, Boreggio L, Salcini AE.
Regulators of H3K4 methylation mutated in neurodevelopmental disorders control axon guidance in Caenorhabditis elegans.
Development 2020 147(15)
[ PubMed ID = 32675280 ]
[ RRC reference ]
|
Lussi YC, Mariani L, Friis C, Peltonen J, Myers TR, Krag C, Wong G, Salcini AE.
Impaired removal of H3K4 methylation affects cell fate determination and gene transcription.
Development 2016 143(20) 3751-3762
[ PubMed ID = 27578789 ]
[ RRC reference ]
|
Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63
[ PubMed ID = 26811384 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.