Mutants (Isolated)

tm3121

Allele Nametm3121
Sequence NameF23D12.5
CGC Namejmjd-3.2
Worm BaseAllele Name tm3121
CGC Name jmjd-3.2
Sequence F23D12.5
Phenotypehomozygous viable. Dr. R.H. Horvitz: pharyngeal morphology normal. Dr. Hongkyun Kim: normal locomotion. Dr. M. Han: normal vulval phenotype. Dr. S. Kennedy: normal RNAi
Mutation site35610/35611-AATTTTTTAATAA-35966/35967 (356 bp deletion + 13 bp insertion)
ChromosomeX
Putative gene structurejoin(34558..34669, 35233..35472, 35659..36149, 36785..37490, 37936..38123, 38170..38762, 38819..39010, 39635..39716)
Map position16.7
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGTTAGAATCCGAGTCTCA,ExtRev:AGGGTCAGTAGGTTTACAAC,ExtFwd:TCGAGTGGATCAGTGCTTCG,IntRev:ACTCTAGAATCGTACCAGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Guillermo ARR, Chocian K, Gavriilidis G, Vandamme J, Salcini AE, Mellor J, Woollard A.
H3K27 modifiers regulate lifespan in C. elegans in a context-dependent manner.
BMC Biol 2021 19(1) 59 
[ PubMed ID = 33766022 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristiz√°bal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colai√°covo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]