| Allele Name | tm3117 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y49E10.11 |
| Gene Name | tat-1 |
| Worm Base | Allele Name |
tm3117
|
| Gene Name |
tat-1
|
| Sequence |
Y49E10.11
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 50225/50226-50592/50593 (367 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(31959..32056, 32642..32766, 37381..37473, 38318..38574, 39898..40038, 40248..40381, 40524..40678, 42286..42815, 44720..45258, 46349..46649, 47456..47568, 48159..48398, 50066..50372, 51442..51627, 52670..52769, 52820..52877, 53218..53260)) |
| Map position | 17.57 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AAAGCAGCTGATCAATACCG,IntFwd:TCAATACCGAAATGTCTGGC,ExtRev:TCCCCACACAGAGTGTAGTC,IntRev:GACGTTAGCCCGACTGGAAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Chen YZ, Klöditz K, Lee ES, Nguyen DP, Yuan Q, Johnson J, Lee-Yow Y, Hall A, Mitani S, Xia NS, Fadeel B, Xue D. Structure and function analysis of the C. elegans aminophospholipid translocase TAT-1. J Cell Sci 2019 132(5)
[ PubMed ID = 30683797 ]
[ RRC reference ]
|
Nichols ALA, Meelkop E, Linton C, Giordano-Santini R, Sullivan RK, Donato A, Nolan C, Hall DH, Xue D, Neumann B, Hilliard MA. The Apoptotic Engulfment Machinery Regulates Axonal Degeneration in C. elegans Neurons. Cell Rep 2016 14(7) 1673-1683
[ PubMed ID = 26876181 ]
[ RRC reference ]
|
Chen YZ, Mapes J, Lee ES, Skeen-Gaar RR, Xue D. Caspase-mediated activation of Caenorhabditis elegans CED-8 promotes apoptosis and phosphatidylserine externalization. Nat Commun 2013 4 2726
[ PubMed ID = 24225442 ]
[ RRC reference ]
|
Mapes J, Chen YZ, Kim A, Mitani S, Kang BH, Xue D. CED-1, CED-7, and TTR-52 regulate surface phosphatidylserine expression on apoptotic and phagocytic cells. Curr Biol 2012 22(14) 1267-75
[ PubMed ID = 22727702 ]
[ RRC reference ]
|
|