Mutants (Isolated)

tm3117

Allele Nametm3117
Sequence NameY49E10.11
CGC Nametat-1
Worm BaseAllele Name tm3117
CGC Name tat-1
Sequence Y49E10.11
Phenotypehomozygous viable.
Mutation site50225/50226-50592/50593 (367 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(31959..32056, 32642..32766, 37381..37473, 38318..38574, 39898..40038, 40248..40381, 40524..40678, 42286..42815, 44720..45258, 46349..46649, 47456..47568, 48159..48398, 50066..50372, 51442..51627, 52670..52769, 52820..52877, 53218..53260))
Map position17.57
Balancer
Map position of balancer
Sequence of primersExtFwd:AAAGCAGCTGATCAATACCG,IntFwd:TCAATACCGAAATGTCTGGC,ExtRev:TCCCCACACAGAGTGTAGTC,IntRev:GACGTTAGCCCGACTGGAAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Chen YZ, Mapes J, Lee ES, Skeen-Gaar RR, Xue D.
Caspase-mediated activation of Caenorhabditis elegans CED-8 promotes apoptosis and phosphatidylserine externalization.
Nat Commun 2013 4 2726 
[ PubMed ID = 24225442 ] [ RRC reference ]

Mapes J, Chen YZ, Kim A, Mitani S, Kang BH, Xue D.
CED-1, CED-7, and TTR-52 regulate surface phosphatidylserine expression on apoptotic and phagocytic cells.
Curr. Biol. 2012 22(14) 1267-75 
[ PubMed ID = 22727702 ] [ RRC reference ]

Nichols ALA, Meelkop E, Linton C, Giordano-Santini R, Sullivan RK, Donato A, Nolan C, Hall DH, Xue D, Neumann B, Hilliard MA.
The Apoptotic Engulfment Machinery Regulates Axonal Degeneration in C. elegans Neurons.
Cell Rep 2016 14(7) 1673-1683 
[ PubMed ID = 26876181 ] [ RRC reference ]