Mutants (Isolated)

tm3081

Allele Nametm3081
Sequence NameW02D3.10
CGC NameW02D3.10
Worm BaseAllele Name tm3081
CGC Name W02D3.10
Sequence W02D3.10
Phenotypehomozygous viable. Dr. H-S. Koo: the germ cells are hypersensitive to interstrand DNA crosslinking.
Mutation site31373/31374-32250/32251 (877 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(26780..26842, 27725..27860, 27957..28048, 28529..28828, 28881..29038, 29087..29365, 29411..29630, 29916..30144, 30269..30800, 30844..31405, 31497..32084, 32136..32213, 32296..32757, 32808..33245, 33288..33464))
Map position1.31
Balancer
Map position of balancer
Sequence of primersExtFwd:CACTGGTTGCCAGAGGCATC,IntFwd:GTGATCAAACTGTCCACCTC,ExtRev:AGTCATCCTTGGAACGGCTC,IntRev:ATGATCGTGGAGGCCGAATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Germoglio M, Valenti A, Gallo I, Forenza C, Santonicola P, Silva N, Adamo A.
In vivo analysis of FANCD2 recruitment at meiotic DNA breaks in Caenorhabditis elegans.
Sci Rep 2020 10(1) 103 
[ PubMed ID = 31919410 ] [ RRC reference ]

Lee KY, Chung KY, Koo HS.
The involvement of FANCM, FANCI, and checkpoint proteins in the interstrand DNA crosslink repair pathway is conserved in C. elegans.
DNA Repair (Amst) 2010 9(4) 374-82 
[ PubMed ID = 20075016 ] [ RRC reference ]

Youds JL, Barber LJ, Boulton SJ.
C. elegans: a model of Fanconi anemia and ICL repair.
Mutat Res 2009 668(1-2) 103-16 
[ PubMed ID = 19059419 ] [ RRC reference ]