Mutants (Isolated)

tm3055

Allele Nametm3055
Sequence NameC18A11.5
CGC Namexol-1
Worm BaseAllele Name tm3055
CGC Name xol-1
Sequence C18A11.5
Phenotypehomozygous viable. Dr. H. Zhang: normal locomotion, male Let.
Mutation site8184/8185-8569/8570 (385 bp deletion)
ChromosomeX
Putative gene structurejoin(8119..8195, 8243..8333, 8378..8563, 9019..9100, 9147..9300, 9347..9722, 10887..11201)
Map position-0.72
Balancer
Map position of balancer
Sequence of primersExtFwd:AACCGTTTTGTTGCAGGGTC,IntFwd:TTGGGGATTGATAGGAGCGA,IntRev:GGGTTGGGGATTGAGCACCA,ExtRev:GGCAACGCGTATTCTAGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chelo IM, Afonso B, Carvalho S, Theologidis I, Goy C, Pino-Querido A, Proulx SR, Teotónio H.
Partial Selfing Can Reduce Genetic Loads While Maintaining Diversity During Experimental Evolution.
G3 (Bethesda) 2019 9(9) 2811-2821 
[ PubMed ID = 31278175 ] [ RRC reference ]

Guzella TS, Dey S, Chelo IM, Pino-Querido A, Pereira VF, Proulx SR, Teotónio H.
Slower environmental change hinders adaptation from standing genetic variation.
PLoS Genet 2018 14(11) e1007731 
[ PubMed ID = 30383789 ] [ RRC reference ]

Plesnar-Bielak A, Labocha MK, Kosztyła P, Woch KR, Banot WM, Sychta K, Skarboń M, Prus MA, Prokop ZM.
Fitness Effects of Thermal Stress Differ Between Outcrossing and Selfing Populations in Caenorhabditis elegans.
Evol Biol 2017 44(3) 356-364 
[ PubMed ID = 28890581 ] [ RRC reference ]

Theologidis I, Chelo IM, Goy C, Teotónio H.
Reproductive assurance drives transitions to self-fertilization in experimental Caenorhabditis elegans.
BMC Biol 2014 12 93 
[ PubMed ID = 25369737 ] [ RRC reference ]