Home > Mutants (Isolated) > tm3045

Mutants (Isolated)

Allele Name		tm3045
Balance		Not Required
OutCross		Not Accepted
Sequence Name		T07A9.1
Gene Name		T07A9.1
Worm Base	Allele Name	tm3045
	Gene Name	T07A9.1
	Sequence	T07A9.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		1797/1798-AAAAAAA-2179/2180 (382 bp deletion + 7 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(667..838, 1096..1337, 1502..1609, 1834..1902))
Map position		-26.25
Balancer
Map position of balancer
Sequence of primers		IntFwd:CTGTACATATCTCTCGGGCA,ExtFwd:TCGCAAGTCCCTCATCATAG,ExtRev:CGAAATAACTGTGTGCGCCT,IntRev:AGGTCGTGCGTTGAATGAGA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Murari E, Meadows D, Cuda N, Mangone M. A comprehensive analysis of 3'UTRs in Caenorhabditis elegans. Nucleic Acids Res 2024 52(13) 7523-7538  [ PubMed ID = 38917330 ] [ RRC reference ] Weng Y, Murphy CT. Male-specific behavioral and transcriptomic changes in aging C. elegans neurons. iScience 2024 27(6) 109910  [ PubMed ID = 38783998 ] [ RRC reference ] Takahashi K, Yoshina S, Masashi M, Ito W, Inoue T, Shiwaku H, Arai H, Mitani S, Okazawa H. Nematode homologue of PQBP1, a mental retardation causative gene, is involved in lipid metabolism. PLoS One 2009 4(1) e4104  [ PubMed ID = 19119319 ] [ RRC reference ]