分離済み変異体

tm3045

Allele Nametm3045
BalanceNot Required
OutCrossNot Accepted
Sequence NameT07A9.1
Gene NameT07A9.1
Worm BaseAllele Name tm3045
Gene Name T07A9.1
Sequence T07A9.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1797/1798-AAAAAAA-2179/2180 (382 bp deletion + 7 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(667..838, 1096..1337, 1502..1609, 1834..1902))
Map position-26.25
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGTACATATCTCTCGGGCA,ExtFwd:TCGCAAGTCCCTCATCATAG,ExtRev:CGAAATAACTGTGTGCGCCT,IntRev:AGGTCGTGCGTTGAATGAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Takahashi K, Yoshina S, Masashi M, Ito W, Inoue T, Shiwaku H, Arai H, Mitani S, Okazawa H.
Nematode homologue of PQBP1, a mental retardation causative gene, is involved in lipid metabolism.
PLoS One 2009 4(1) e4104 
[ PubMed ID = 19119319 ] [ RRC reference ]