Mutants (Isolated)

tm3042

Allele Nametm3042
Sequence NameW03H9.4
CGC NameW03H9.4
Worm BaseAllele Name tm3042
CGC Name W03H9.4
Sequence W03H9.4
Phenotypelethal or sterile. Dr. E. Cram: L1-L2 arrest, Mlt.
Mutation site53/54-235/236 (182 bp deletion)
ChromosomeII
Putative gene structurejoin(complement(600..634), complement(200..547), complement(101..112), complement(Z83234.1:37487..37788), complement(Z83234.1:36349..36548), complement(Z83234.1:32443..32930), complement(Z83234.1:31188..31569), complement(Z83234.1:29780..30016))
Map position22.39
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CGGCTTGCCGAGCAAAGATC,ExtRev:AGAGATCGCCTTCAACGTCC,IntFwd:CGCCGTATGTGGATTCTCGT,ExtFwd:TCGGGAATTTTCGCCGTATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
LaBonty M, Szmygiel C, Byrnes LE, Hughes S, Woollard A, Cram EJ.
CACN-1/Cactin plays a role in Wnt signaling in C. elegans.
PLoS ONE 2014 9(7) e101945 
[ PubMed ID = 24999833 ] [ RRC reference ]

Tannoury H, Rodriguez V, Kovacevic I, Ibourk M, Lee M, Cram EJ.
CACN-1/Cactin interacts genetically with MIG-2 GTPase signaling to control distal tip cell migration in C. elegans.
Dev. Biol. 2010 341(1) 176-85 
[ PubMed ID = 20188721 ] [ RRC reference ]

Matus DQ, Li XY, Durbin S, Agarwal D, Chi Q, Weiss SJ, Sherwood DR.
In vivo identification of regulators of cell invasion across basement membranes.
Sci Signal 2010 3(120) ra35 
[ PubMed ID = 20442418 ] [ RRC reference ]