Allele Name | tm3042 |
Allele Type | 通常株 |
Sequence Name | W03H9.4 |
Gene Name | cacn-1 |
Worm Base | Allele Name |
tm3042
|
Gene Name |
cacn-1
|
Sequence |
W03H9.4
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. E. Cram: L1-L2 arrest, Mlt. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 53/54-235/236 (182 bp deletion) |
Chromosome | II |
Putative gene structure | complement(join(29517..30017, 31189..31570, 32474..32931, 36350..36549, 37488..[W03H9]112, 200..547, 600..644)) |
Map position | 22.45 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:CGGCTTGCCGAGCAAAGATC,ExtRev:AGAGATCGCCTTCAACGTCC,IntFwd:CGCCGTATGTGGATTCTCGT,ExtFwd:TCGGGAATTTTCGCCGTATG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Cecchetelli AD, Hugunin J, Tannoury H, Cram EJ. CACN-1 is required in the Caenorhabditis elegans somatic gonad for proper oocyte development. Dev Biol 2016 414(1) 58-71
[ PubMed ID = 27046631 ]
[ RRC reference ]
|
Tannoury H, Rodriguez V, Kovacevic I, Ibourk M, Lee M, Cram EJ. CACN-1/Cactin interacts genetically with MIG-2 GTPase signaling to control distal tip cell migration in C. elegans. Dev Biol 2010 341(1) 176-85
[ PubMed ID = 20188721 ]
[ RRC reference ]
|
Matus DQ, Li XY, Durbin S, Agarwal D, Chi Q, Weiss SJ, Sherwood DR. In vivo identification of regulators of cell invasion across basement membranes. Sci Signal 2010 3(120) ra35
[ PubMed ID = 20442418 ]
[ RRC reference ]
|
LaBonty M, Szmygiel C, Byrnes LE, Hughes S, Woollard A, Cram EJ. CACN-1/Cactin plays a role in Wnt signaling in C. elegans. PLoS One 2014 9(7) e101945
[ PubMed ID = 24999833 ]
[ RRC reference ]
|
|