Mutants (Isolated)

tm3041

Allele Nametm3041
Allele TypeNormal
Sequence NameF55F8.6
Gene NameF55F8.6
Worm BaseAllele Name tm3041
Gene Name F55F8.6
Sequence F55F8.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12966/12967-T-13426/13427 (460 bp deletion + 1 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(13063..13272, 13321..13596))
Map position0.3
Balancer
Map position of balancer
Sequence of primersIntRev:CGTTCCGGAGCACATCACAG,ExtRev:CCTAGGAACCGACAAGCGAA,IntFwd:GTATGAAGGGGACTAACGAA,ExtFwd:ACCGTATGAAGGGGACTAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216 
[ PubMed ID = 32294300 ] [ RRC reference ]

Machiela E, Liontis T, Dues DJ, Rudich PD, Traa A, Wyman L, Kaufman C, Cooper JF, Lew L, Nadarajan S, Senchuk MM, Van Raamsdonk JM.
Disruption of mitochondrial dynamics increases stress resistance through activation of multiple stress response pathways.
FASEB J 2020 34(6) 8475-8492 
[ PubMed ID = 32385951 ] [ RRC reference ]

Shen Q, Yamano K, Head BP, Kawajiri S, Cheung JT, Wang C, Cho JH, Hattori N, Youle RJ, van der Bliek AM.
Mutations in Fis1 disrupt orderly disposal of defective mitochondria.
Mol Biol Cell 2014 25(1) 145-59 
[ PubMed ID = 24196833 ] [ RRC reference ]