Mutants (Isolated)

tm3024

Allele Nametm3024
Sequence NameY11D7A.13
CGC NameY11D7A.13
Worm BaseAllele Name tm3024
CGC Name Y11D7A.13
Sequence Y11D7A.13
Phenotypehomozygous viable. Dr. V. Ambros: Genes & Dev. 22, 2520 (2008).
Mutation site42617/42618-42954/42955 (337 bp deletion)
ChromosomeIV
Putative gene structurejoin(42281..42610, 42709..43047, 43154..43549, 43605..43802)
Map position4.13
Balancer
Map position of balancer
Sequence of primersExtFwd:ACTAACAGTGCAGGCTGTAA,IntFwd:ACAGTGCAGGCTGTAATCTC,ExtRev:GGGCAATATGCGCTCTTTAG,IntRev:CGGTTCTCCATTGATCGATC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ow MC, Martinez NJ, Olsen PH, Silverman HS, Barrasa MI, Conradt B, Walhout AJ, Ambros V.
The FLYWCH transcription factors FLH-1, FLH-2, and FLH-3 repress embryonic expression of microRNA genes in C. elegans.
Genes Dev. 2008 22(18) 2520-34 
[ PubMed ID = 18794349 ] [ RRC reference ]